Incidental Mutation 'R5944:Cenpj'
ID460494
Institutional Source Beutler Lab
Gene Symbol Cenpj
Ensembl Gene ENSMUSG00000064128
Gene Namecentromere protein J
Synonyms4932437H03Rik, Sas4
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56526761-56575425 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 56553658 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]
Predicted Effect probably null
Transcript: ENSMUST00000065302
SMART Domains Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
coiled coil region 140 185 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
low complexity region 860 871 N/A INTRINSIC
coiled coil region 899 1046 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Pfam:Tcp10_C 1167 1342 5.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000225951
Predicted Effect probably benign
Transcript: ENSMUST00000229861
Meta Mutation Damage Score 0.9584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Spatc1 T C 15: 76,283,938 L199P probably damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Cenpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cenpj APN 14 56553030 missense probably benign 0.04
IGL00969:Cenpj APN 14 56564963 missense possibly damaging 0.68
IGL01152:Cenpj APN 14 56552300 missense probably benign 0.01
IGL01475:Cenpj APN 14 56565045 missense possibly damaging 0.80
IGL01548:Cenpj APN 14 56532319 missense probably benign 0.00
IGL01893:Cenpj APN 14 56553474 missense probably damaging 1.00
IGL02647:Cenpj APN 14 56530079 missense probably damaging 0.99
IGL02683:Cenpj APN 14 56552952 missense possibly damaging 0.88
IGL02691:Cenpj APN 14 56552090 missense probably benign 0.28
IGL03008:Cenpj APN 14 56526949 missense probably benign 0.39
R0206:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0208:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0356:Cenpj UTSW 14 56549496 missense probably damaging 1.00
R0942:Cenpj UTSW 14 56555209 unclassified probably benign
R1392:Cenpj UTSW 14 56534854 splice site probably benign
R1564:Cenpj UTSW 14 56552066 missense probably benign 0.43
R1671:Cenpj UTSW 14 56565045 missense probably damaging 0.99
R1889:Cenpj UTSW 14 56558725 missense probably benign 0.43
R2059:Cenpj UTSW 14 56563955 missense possibly damaging 0.94
R2140:Cenpj UTSW 14 56526932 missense probably damaging 1.00
R2509:Cenpj UTSW 14 56532237 missense probably null 0.98
R2866:Cenpj UTSW 14 56552180 missense probably benign 0.01
R3813:Cenpj UTSW 14 56553222 missense probably benign 0.05
R4620:Cenpj UTSW 14 56535454 missense probably damaging 0.99
R4670:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4671:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4765:Cenpj UTSW 14 56549545 nonsense probably null
R4915:Cenpj UTSW 14 56553718 missense probably damaging 0.98
R4930:Cenpj UTSW 14 56534781 nonsense probably null
R5088:Cenpj UTSW 14 56553691 missense probably damaging 1.00
R5523:Cenpj UTSW 14 56552423 missense probably benign 0.00
R5527:Cenpj UTSW 14 56526983 missense probably damaging 1.00
R5717:Cenpj UTSW 14 56553521 frame shift probably null
R5975:Cenpj UTSW 14 56564066 missense possibly damaging 0.92
R6019:Cenpj UTSW 14 56534815 missense probably benign 0.01
R6291:Cenpj UTSW 14 56551976 missense probably benign 0.01
R6948:Cenpj UTSW 14 56553226 missense probably damaging 0.96
R7212:Cenpj UTSW 14 56552652 missense probably benign 0.00
R7461:Cenpj UTSW 14 56527044 nonsense probably null
R7613:Cenpj UTSW 14 56527044 nonsense probably null
R7634:Cenpj UTSW 14 56542800 missense probably benign 0.00
R7837:Cenpj UTSW 14 56558728 missense probably benign 0.02
RF007:Cenpj UTSW 14 56530048 critical splice donor site probably null
Z1177:Cenpj UTSW 14 56552879 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TAAACCTAGCTAAACCTTCTCCTCG -3'
(R):5'- TGGTCCTGGAGAATGCTAGC -3'

Sequencing Primer
(F):5'- CTCCTCGTTTTAAAAATGGTTGC -3'
(R):5'- CAGGCTGAGGTATTGACTATTACACG -3'
Posted On2017-02-28