Incidental Mutation 'R5944:Spatc1'
ID460497
Institutional Source Beutler Lab
Gene Symbol Spatc1
Ensembl Gene ENSMUSG00000049653
Gene Namespermatogenesis and centriole associated 1
Synonymssperiolin, 1700084J23Rik
MMRRC Submission 044136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5944 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76268089-76292572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76283938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 199 (L199P)
Ref Sequence ENSEMBL: ENSMUSP00000155378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074173] [ENSMUST00000230221]
Predicted Effect probably damaging
Transcript: ENSMUST00000074173
AA Change: L199P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653
AA Change: L199P

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230221
AA Change: L199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G T 5: 114,245,980 R2190L probably damaging Het
Ankrd17 C T 5: 90,285,843 R689H probably damaging Het
Apol7b A T 15: 77,423,767 V176E probably damaging Het
Arsg T C 11: 109,535,311 F319S probably damaging Het
Bcar3 T A 3: 122,523,283 D634E probably benign Het
Bend7 T C 2: 4,744,356 W95R probably damaging Het
Cenpj A G 14: 56,553,658 probably null Het
Clasrp A T 7: 19,594,506 Y116N probably damaging Het
Cldn17 T C 16: 88,506,709 E44G probably damaging Het
Cyfip1 G A 7: 55,872,130 E61K probably damaging Het
Dcaf13 A C 15: 39,146,677 M419L probably benign Het
Eml4 A G 17: 83,446,043 D269G possibly damaging Het
Fap T C 2: 62,542,261 Y258C probably damaging Het
Fdxr T A 11: 115,269,846 T288S probably benign Het
Frs3 T C 17: 47,692,308 probably benign Het
Gm5581 T A 6: 131,168,400 noncoding transcript Het
Gm7964 A G 7: 83,756,535 D187G probably benign Het
Gpc5 T C 14: 115,369,838 V284A probably benign Het
Hspa9 T C 18: 34,949,023 T177A possibly damaging Het
Ifi202b T A 1: 173,963,799 M438L probably benign Het
Ighv1-3 T C 12: 114,481,619 probably benign Het
Krt36 G T 11: 100,105,313 A95E probably benign Het
Krt9 C T 11: 100,188,439 S709N unknown Het
Lmntd1 A T 6: 145,427,316 S164T probably damaging Het
Maats1 G T 16: 38,328,310 T252N probably damaging Het
Olfr1442 C T 19: 12,674,919 T238I probably damaging Het
Olfr295 T A 7: 86,585,278 M1K probably null Het
Olfr503 G A 7: 108,545,277 A249T possibly damaging Het
Olfr57 A T 10: 79,035,389 M198L probably benign Het
Olfr694 A T 7: 106,689,646 C28* probably null Het
Papola T A 12: 105,812,385 F341I possibly damaging Het
Phf3 A G 1: 30,820,704 L914P probably damaging Het
Sec24d T C 3: 123,293,581 V132A probably benign Het
Serpini1 G A 3: 75,640,299 D373N probably damaging Het
Sigirr T C 7: 141,091,387 Y394C probably damaging Het
Slc29a4 G A 5: 142,718,818 E372K probably damaging Het
Slc7a4 C T 16: 17,574,356 V405I possibly damaging Het
Srgap3 T C 6: 112,795,814 M149V possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stat3 C T 11: 100,895,105 A449T probably damaging Het
Stat4 A G 1: 52,074,739 N203D probably damaging Het
Tanc1 T C 2: 59,837,220 probably null Het
Trav3-1 T C 14: 52,580,992 I41T probably benign Het
Usp34 T A 11: 23,363,089 D525E probably damaging Het
Vars T C 17: 35,013,644 V848A probably damaging Het
Vmn2r101 A T 17: 19,589,507 D185V probably benign Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Spatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Spatc1 APN 15 76284794 missense probably damaging 1.00
IGL02215:Spatc1 APN 15 76283539 splice site probably benign
IGL02678:Spatc1 APN 15 76292372 missense probably damaging 1.00
R0452:Spatc1 UTSW 15 76268293 missense probably damaging 1.00
R1972:Spatc1 UTSW 15 76284875 intron probably null
R2066:Spatc1 UTSW 15 76283537 splice site probably null
R2921:Spatc1 UTSW 15 76283925 missense probably damaging 1.00
R3689:Spatc1 UTSW 15 76268295 nonsense probably null
R3690:Spatc1 UTSW 15 76268295 nonsense probably null
R4519:Spatc1 UTSW 15 76292485 missense probably damaging 1.00
R7008:Spatc1 UTSW 15 76283723 missense probably benign 0.00
R7034:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7036:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7436:Spatc1 UTSW 15 76268368 missense probably benign 0.21
X0023:Spatc1 UTSW 15 76268372 missense possibly damaging 0.87
Z1177:Spatc1 UTSW 15 76283853
Predicted Primers PCR Primer
(F):5'- TTGTGCCATGCTCCATGAG -3'
(R):5'- AAAGTTTCCTCGGGTAGGCTC -3'

Sequencing Primer
(F):5'- TCCATGAGCAACCAACTGAC -3'
(R):5'- ACCCTTGGCGTCTCTGG -3'
Posted On2017-02-28