Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Esf1'

46050

Institutional Source

Beutler Lab

Gene Symbol

Esf1

Ensembl Gene

ENSMUSG00000045624

Gene Name

ESF1 nucleolar pre-rRNA processing protein homolog

Synonyms

MMRRC Submission

038755-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R0564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140119883-140170564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 140158586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 427 (Y427N)

Ref Sequence

ENSEMBL: ENSMUSP00000036523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046030]

AlphaFold

Q3V1V3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046030
AA Change: Y427N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: Y427N

Domain	Start	End	E-Value	Type
coiled coil region	91	114	N/A	INTRINSIC
low complexity region	192	207	N/A	INTRINSIC
low complexity region	230	258	N/A	INTRINSIC
coiled coil region	261	293	N/A	INTRINSIC
low complexity region	539	552	N/A	INTRINSIC
coiled coil region	628	652	N/A	INTRINSIC
low complexity region	667	692	N/A	INTRINSIC
low complexity region	730	740	N/A	INTRINSIC
Pfam:NUC153	753	781	4.1e-15	PFAM
low complexity region	784	798	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141086

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153769

Meta Mutation Damage Score

0.9622

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Col6a3	A	C	1: 90,807,734	V731G	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mpp3	T	G	11: 102,005,347	K450T	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sema3e	T	A	5: 14,236,085		probably null	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Trio	T	C	15: 27,805,822	N527D	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Esf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Esf1	APN	2	140167817	missense	probably benign	0.09
IGL01075:Esf1	APN	2	140120745	missense	probably benign	0.01
IGL01777:Esf1	APN	2	140157172	splice site	probably null
IGL01863:Esf1	APN	2	140120679	missense	probably benign	0.00
IGL01982:Esf1	APN	2	140164528	missense	probably benign	0.00
IGL02040:Esf1	APN	2	140129261	missense	possibly damaging	0.70
IGL02063:Esf1	APN	2	140164457	missense	possibly damaging	0.88
IGL03063:Esf1	APN	2	140154786	unclassified	probably benign
PIT4418001:Esf1	UTSW	2	140159777	missense	probably benign	0.18
R0255:Esf1	UTSW	2	140148923	unclassified	probably benign
R0388:Esf1	UTSW	2	140120871	missense	possibly damaging	0.71
R0655:Esf1	UTSW	2	140148879	missense	probably benign	0.25
R0831:Esf1	UTSW	2	140168359	missense	probably damaging	1.00
R1642:Esf1	UTSW	2	140158486	missense	possibly damaging	0.85
R1984:Esf1	UTSW	2	140148886	missense	possibly damaging	0.83
R3981:Esf1	UTSW	2	140158556	missense	probably benign	0.40
R4736:Esf1	UTSW	2	140124971	missense	probably damaging	0.98
R5083:Esf1	UTSW	2	140157071	missense	possibly damaging	0.93
R5083:Esf1	UTSW	2	140158579	missense	possibly damaging	0.96
R5222:Esf1	UTSW	2	140158583	missense	possibly damaging	0.86
R5347:Esf1	UTSW	2	140154881	nonsense	probably null
R5654:Esf1	UTSW	2	140164228	missense	possibly damaging	0.85
R6123:Esf1	UTSW	2	140168389	missense	probably benign	0.01
R6132:Esf1	UTSW	2	140159779	missense	probably benign	0.18
R6299:Esf1	UTSW	2	140123634	missense	possibly damaging	0.53
R6484:Esf1	UTSW	2	140158538	missense	probably benign	0.03
R6541:Esf1	UTSW	2	140167879	missense	probably benign	0.00
R6674:Esf1	UTSW	2	140120806	nonsense	probably null
R7203:Esf1	UTSW	2	140164219	missense	possibly damaging	0.53
R7309:Esf1	UTSW	2	140125091	splice site	probably null
R7379:Esf1	UTSW	2	140154934	missense	probably benign	0.33
R8131:Esf1	UTSW	2	140148831	nonsense	probably null
R8270:Esf1	UTSW	2	140155113	unclassified	probably benign
R9066:Esf1	UTSW	2	140148773	missense	probably benign	0.02
R9186:Esf1	UTSW	2	140148872	missense	possibly damaging	0.96
R9618:Esf1	UTSW	2	140159794	missense	probably benign	0.03
R9688:Esf1	UTSW	2	140168175	missense	probably damaging	0.97
RF006:Esf1	UTSW	2	140164374	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTAAGAGATGAACTggggctgga -3'
(R):5'- AGCATTTGAGCTGATATCTCACAAGCA -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- TGTGGAGCAGGAATTACAGG -3'

Posted On

2013-06-11