Mutagenetix > Incidental Mutations

Incidental Mutation 'R5944:Hspa9'

460507

Institutional Source

Beutler Lab

Gene Symbol

Hspa9

Ensembl Gene

ENSMUSG00000024359

Gene Name

heat shock protein 9

Synonyms

C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin

MMRRC Submission

044136-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R5944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34937414-34954357 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34949023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 177 (T177A)

Ref Sequence

ENSEMBL: ENSMUSP00000025217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025217]

AlphaFold

P38647

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025217
AA Change: T177A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: T177A

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Pfam:HSP70	55	653	2.7e-270	PFAM
Pfam:FGGY_C	283	429	3e-8	PFAM
low complexity region	657	679	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173806

Meta Mutation Damage Score

0.4010

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	T	5: 114,245,980	R2190L	probably damaging	Het
Ankrd17	C	T	5: 90,285,843	R689H	probably damaging	Het
Apol7b	A	T	15: 77,423,767	V176E	probably damaging	Het
Arsg	T	C	11: 109,535,311	F319S	probably damaging	Het
Bcar3	T	A	3: 122,523,283	D634E	probably benign	Het
Bend7	T	C	2: 4,744,356	W95R	probably damaging	Het
Cenpj	A	G	14: 56,553,658		probably null	Het
Clasrp	A	T	7: 19,594,506	Y116N	probably damaging	Het
Cldn17	T	C	16: 88,506,709	E44G	probably damaging	Het
Cyfip1	G	A	7: 55,872,130	E61K	probably damaging	Het
Dcaf13	A	C	15: 39,146,677	M419L	probably benign	Het
Eml4	A	G	17: 83,446,043	D269G	possibly damaging	Het
Fap	T	C	2: 62,542,261	Y258C	probably damaging	Het
Fdxr	T	A	11: 115,269,846	T288S	probably benign	Het
Frs3	T	C	17: 47,692,308		probably benign	Het
Gm5581	T	A	6: 131,168,400		noncoding transcript	Het
Gm7964	A	G	7: 83,756,535	D187G	probably benign	Het
Gpc5	T	C	14: 115,369,838	V284A	probably benign	Het
Ifi202b	T	A	1: 173,963,799	M438L	probably benign	Het
Ighv1-3	T	C	12: 114,481,619		probably benign	Het
Krt36	G	T	11: 100,105,313	A95E	probably benign	Het
Krt9	C	T	11: 100,188,439	S709N	unknown	Het
Lmntd1	A	T	6: 145,427,316	S164T	probably damaging	Het
Maats1	G	T	16: 38,328,310	T252N	probably damaging	Het
Olfr1442	C	T	19: 12,674,919	T238I	probably damaging	Het
Olfr295	T	A	7: 86,585,278	M1K	probably null	Het
Olfr503	G	A	7: 108,545,277	A249T	possibly damaging	Het
Olfr57	A	T	10: 79,035,389	M198L	probably benign	Het
Olfr694	A	T	7: 106,689,646	C28*	probably null	Het
Papola	T	A	12: 105,812,385	F341I	possibly damaging	Het
Phf3	A	G	1: 30,820,704	L914P	probably damaging	Het
Sec24d	T	C	3: 123,293,581	V132A	probably benign	Het
Serpini1	G	A	3: 75,640,299	D373N	probably damaging	Het
Sigirr	T	C	7: 141,091,387	Y394C	probably damaging	Het
Slc29a4	G	A	5: 142,718,818	E372K	probably damaging	Het
Slc7a4	C	T	16: 17,574,356	V405I	possibly damaging	Het
Spatc1	T	C	15: 76,283,938	L199P	probably damaging	Het
Srgap3	T	C	6: 112,795,814	M149V	possibly damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stat3	C	T	11: 100,895,105	A449T	probably damaging	Het
Stat4	A	G	1: 52,074,739	N203D	probably damaging	Het
Tanc1	T	C	2: 59,837,220		probably null	Het
Trav3-1	T	C	14: 52,580,992	I41T	probably benign	Het
Usp34	T	A	11: 23,363,089	D525E	probably damaging	Het
Vars	T	C	17: 35,013,644	V848A	probably damaging	Het
Vmn2r101	A	T	17: 19,589,507	D185V	probably benign	Het
Wiz	A	G	17: 32,357,697	S628P	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Hspa9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Hspa9	APN	18	34938580	splice site	probably benign
IGL01939:Hspa9	APN	18	34938708	missense	possibly damaging	0.89
IGL02008:Hspa9	APN	18	34947975	nonsense	probably null
IGL02604:Hspa9	APN	18	34954213	missense	unknown
Chiri-san	UTSW	18	34939423	missense	probably damaging	1.00
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0278:Hspa9	UTSW	18	34940910	missense	possibly damaging	0.50
R0613:Hspa9	UTSW	18	34947980	missense	probably damaging	1.00
R1414:Hspa9	UTSW	18	34938591	missense	probably damaging	1.00
R1454:Hspa9	UTSW	18	34938606	missense	probably damaging	1.00
R2013:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2014:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2015:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2936:Hspa9	UTSW	18	34948014	missense	probably damaging	1.00
R4261:Hspa9	UTSW	18	34939423	missense	probably damaging	1.00
R4622:Hspa9	UTSW	18	34949037	missense	possibly damaging	0.48
R4819:Hspa9	UTSW	18	34939388	missense	probably damaging	0.98
R5056:Hspa9	UTSW	18	34938681	missense	probably damaging	1.00
R5223:Hspa9	UTSW	18	34952671	splice site	probably null
R5666:Hspa9	UTSW	18	34954247	missense	probably null
R5820:Hspa9	UTSW	18	34943174	missense	possibly damaging	0.82
R6460:Hspa9	UTSW	18	34952712	missense	probably benign
R7404:Hspa9	UTSW	18	34943276	missense	possibly damaging	0.76
R7412:Hspa9	UTSW	18	34949029	missense	probably damaging	1.00
R7637:Hspa9	UTSW	18	34938687	missense	not run
R8524:Hspa9	UTSW	18	34954244	missense	unknown
R8830:Hspa9	UTSW	18	34948104	critical splice donor site	probably null
R8987:Hspa9	UTSW	18	34947929	missense	probably damaging	1.00
R9028:Hspa9	UTSW	18	34942031	missense	probably damaging	1.00
R9184:Hspa9	UTSW	18	34949115	missense	possibly damaging	0.87
Z1177:Hspa9	UTSW	18	34943145	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGCTTTTGTGCAACAGCAGAG -3'
(R):5'- TAGAGTGGTAAGTTTCACAGGG -3'

Sequencing Primer
(F):5'- CTTTTGTGCAACAGCAGAGATGTTAG -3'
(R):5'- GGTAAGTTTCACAGGGATAGTTTAC -3'

Posted On

2017-02-28