Incidental Mutation 'R5945:Ddx31'
ID 460516
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 044137-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R5945 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28749902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 308 (I308N)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: I308N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: I308N

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152685
Meta Mutation Damage Score 0.3956 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,326,601 (GRCm39) noncoding transcript Het
Abca13 C T 11: 9,243,398 (GRCm39) H1754Y probably benign Het
Abi1 T C 2: 22,929,977 (GRCm39) E34G probably damaging Het
Apobec3 C T 15: 79,782,047 (GRCm39) T19I probably damaging Het
Arel1 C A 12: 84,973,121 (GRCm39) V559L probably benign Het
Arhgef10 T C 8: 15,030,028 (GRCm39) probably null Het
Asb6 T C 2: 30,718,215 (GRCm39) probably benign Het
Asxl2 T C 12: 3,550,439 (GRCm39) V727A possibly damaging Het
Atp13a5 C A 16: 29,055,995 (GRCm39) R1100L probably benign Het
Atp6v1a A G 16: 43,920,309 (GRCm39) V429A probably damaging Het
Caml A G 13: 55,776,445 (GRCm39) Y228C probably damaging Het
Ccdc14 A G 16: 34,543,958 (GRCm39) E772G probably damaging Het
Ccdc96 A G 5: 36,643,194 (GRCm39) E400G probably damaging Het
Ces1h T A 8: 94,090,254 (GRCm39) E266V probably benign Het
Chd5 G T 4: 152,464,408 (GRCm39) Q1522H probably benign Het
CN725425 T A 15: 91,129,980 (GRCm39) I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 (GRCm39) E62V probably null Het
Cops5 T A 1: 10,108,235 (GRCm39) probably benign Het
Crhr2 T A 6: 55,077,667 (GRCm39) I232F possibly damaging Het
Cxcl3 C T 5: 90,934,175 (GRCm39) probably benign Het
Efcab14 T A 4: 115,613,664 (GRCm39) V204D probably damaging Het
Emsy T C 7: 98,268,590 (GRCm39) T484A probably damaging Het
Ep400 A T 5: 110,830,732 (GRCm39) I2257N unknown Het
Epb41l4a T A 18: 33,961,783 (GRCm39) Q420L possibly damaging Het
Fat4 A G 3: 39,037,355 (GRCm39) D3669G probably benign Het
Fmnl2 C A 2: 53,004,211 (GRCm39) T607K probably damaging Het
Glod4 T C 11: 76,125,297 (GRCm39) Y135C probably damaging Het
Gm10912 A G 2: 103,896,961 (GRCm39) I33M possibly damaging Het
Gm5592 T C 7: 40,865,036 (GRCm39) probably benign Het
Gria4 A G 9: 4,456,122 (GRCm39) L726P probably damaging Het
H2-M10.4 T C 17: 36,771,518 (GRCm39) E220G probably benign Het
Itga1 T G 13: 115,103,126 (GRCm39) N1102H probably benign Het
Itpk1 A G 12: 102,554,812 (GRCm39) I6T probably damaging Het
Kcnh4 T C 11: 100,636,148 (GRCm39) D833G probably damaging Het
Kdm1a T C 4: 136,296,012 (GRCm39) probably null Het
Kif24 G A 4: 41,428,670 (GRCm39) Q97* probably null Het
Klhl2 T C 8: 65,202,762 (GRCm39) I479V probably benign Het
Large1 T C 8: 73,578,828 (GRCm39) Y459C probably damaging Het
Lcn8 T G 2: 25,545,509 (GRCm39) L169R probably damaging Het
Loxl3 T G 6: 83,014,492 (GRCm39) S133R probably damaging Het
Lyzl4 A G 9: 121,413,529 (GRCm39) Y4H unknown Het
Marchf7 A G 2: 60,071,331 (GRCm39) K612E probably damaging Het
Mreg C T 1: 72,231,359 (GRCm39) G33D probably benign Het
Ms4a6c A C 19: 11,457,863 (GRCm39) probably benign Het
Nrbf2 G A 10: 67,103,299 (GRCm39) S268F possibly damaging Het
Oog4 T A 4: 143,164,293 (GRCm39) I341F probably benign Het
Or4k5 A G 14: 50,386,220 (GRCm39) V37A probably benign Het
Or5h26 A G 16: 58,988,482 (GRCm39) L8P probably benign Het
Or5h27 C T 16: 59,006,091 (GRCm39) V252I unknown Het
Or5l14 A T 2: 87,792,946 (GRCm39) C97S probably damaging Het
Pcdhb5 G A 18: 37,454,523 (GRCm39) R301Q probably benign Het
Podn T C 4: 107,878,910 (GRCm39) K174R possibly damaging Het
Pphln1 T C 15: 93,353,413 (GRCm39) probably null Het
Ppp2r1a C G 17: 21,179,675 (GRCm39) H112D possibly damaging Het
Prmt5 A G 14: 54,752,344 (GRCm39) F151L possibly damaging Het
Ptch1 A T 13: 63,721,233 (GRCm39) probably benign Het
Rgl2 A G 17: 34,151,012 (GRCm39) probably null Het
Ryr2 A T 13: 11,675,008 (GRCm39) I3373N probably damaging Het
Scap A G 9: 110,213,664 (GRCm39) N1209S probably benign Het
Sin3b T C 8: 73,457,793 (GRCm39) S170P probably damaging Het
Slc22a4 A T 11: 53,886,854 (GRCm39) I296N probably damaging Het
Slco1a8 T A 6: 141,940,008 (GRCm39) N145I probably damaging Het
Slco2a1 T C 9: 102,923,989 (GRCm39) S68P probably damaging Het
Snx8 A G 5: 140,339,235 (GRCm39) C161R probably benign Het
Spryd3 C T 15: 102,026,630 (GRCm39) C347Y probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Strn3 T C 12: 51,676,279 (GRCm39) T333A probably benign Het
Swt1 T A 1: 151,286,921 (GRCm39) E190D probably benign Het
Tchh A T 3: 93,352,644 (GRCm39) I695F unknown Het
Tfap4 G A 16: 4,363,493 (GRCm39) S314L possibly damaging Het
Tigd3 G T 19: 5,941,894 (GRCm39) T412K probably benign Het
Tmem184b T A 15: 79,249,681 (GRCm39) probably null Het
Trpa1 T C 1: 14,968,359 (GRCm39) D469G probably benign Het
Tssk1 T C 16: 17,712,565 (GRCm39) F117L probably damaging Het
Tuba3b T A 6: 145,565,471 (GRCm39) M313K probably damaging Het
Tubgcp6 T C 15: 88,993,420 (GRCm39) probably null Het
Vav1 A G 17: 57,608,870 (GRCm39) K345E possibly damaging Het
Zdhhc4 G A 5: 143,310,641 (GRCm39) R64C probably damaging Het
Zfp280d T A 9: 72,269,614 (GRCm39) L892* probably null Het
Zfp46 T A 4: 136,014,528 (GRCm39) M3K probably damaging Het
Zfp607b C A 7: 27,401,841 (GRCm39) P99Q probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp990 T A 4: 145,264,613 (GRCm39) I537N probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGTGCAGACAACCTGATG -3'
(R):5'- CCTTAGATGGGTCCAGATCTAAGC -3'

Sequencing Primer
(F):5'- TGCAGACAACCTGATGAGAAC -3'
(R):5'- CACTTTTGCAGGATGAAGGC -3'
Posted On 2017-02-28