Incidental Mutation 'R5945:Cngb3'
ID460527
Institutional Source Beutler Lab
Gene Symbol Cngb3
Ensembl Gene ENSMUSG00000056494
Gene Namecyclic nucleotide gated channel beta 3
SynonymsCCNC2, CNG6, Cngbeta2
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5945 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19280850-19510623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19283579 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 62 (E62V)
Ref Sequence ENSEMBL: ENSMUSP00000100064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102999]
Predicted Effect probably null
Transcript: ENSMUST00000102999
AA Change: E62V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: E62V

DomainStartEndE-ValueType
Pfam:Ion_trans 210 445 5.7e-21 PFAM
cNMP 516 635 5.99e-23 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc14 A G 16: 34,723,588 E772G probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Epb41l4a T A 18: 33,828,730 Q420L possibly damaging Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Olfr729 A G 14: 50,148,763 V37A probably benign Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Ptch1 A T 13: 63,573,419 probably benign Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Strn3 T C 12: 51,629,496 T333A probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Cngb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Cngb3 APN 4 19280956 missense probably damaging 0.98
IGL01301:Cngb3 APN 4 19425625 missense probably damaging 1.00
IGL01735:Cngb3 APN 4 19415648 missense probably damaging 1.00
IGL01756:Cngb3 APN 4 19367850 missense probably damaging 1.00
IGL01812:Cngb3 APN 4 19461728 missense possibly damaging 0.86
IGL02123:Cngb3 APN 4 19367801 missense probably damaging 0.99
IGL02636:Cngb3 APN 4 19396690 missense probably damaging 1.00
IGL02648:Cngb3 APN 4 19428489 missense probably benign 0.00
IGL02935:Cngb3 APN 4 19425491 missense possibly damaging 0.95
IGL03025:Cngb3 APN 4 19283498 splice site probably benign
IGL03068:Cngb3 APN 4 19375246 missense possibly damaging 0.92
braced UTSW 4 19395922 splice site probably benign
ANU18:Cngb3 UTSW 4 19425625 missense probably damaging 1.00
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0195:Cngb3 UTSW 4 19280975 missense probably benign 0.00
R0361:Cngb3 UTSW 4 19366467 missense probably benign 0.00
R0480:Cngb3 UTSW 4 19309517 splice site probably benign
R1103:Cngb3 UTSW 4 19309658 critical splice donor site probably null
R1450:Cngb3 UTSW 4 19395922 splice site probably benign
R1618:Cngb3 UTSW 4 19364260 missense probably benign
R1891:Cngb3 UTSW 4 19366446 missense probably benign 0.00
R2196:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R2850:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R3909:Cngb3 UTSW 4 19461679 missense probably damaging 1.00
R3941:Cngb3 UTSW 4 19396786 missense probably benign 0.00
R4348:Cngb3 UTSW 4 19396688 missense probably damaging 1.00
R4490:Cngb3 UTSW 4 19415684 missense probably benign 0.41
R4493:Cngb3 UTSW 4 19367778 missense probably damaging 1.00
R4578:Cngb3 UTSW 4 19425613 missense probably damaging 1.00
R4719:Cngb3 UTSW 4 19309562 missense probably benign
R4774:Cngb3 UTSW 4 19415713 missense possibly damaging 0.85
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4898:Cngb3 UTSW 4 19395926 missense probably benign 0.08
R5216:Cngb3 UTSW 4 19415729 missense possibly damaging 0.93
R5647:Cngb3 UTSW 4 19364266 missense possibly damaging 0.51
R6586:Cngb3 UTSW 4 19280946 missense probably damaging 0.99
R6650:Cngb3 UTSW 4 19364168 missense probably damaging 1.00
R6651:Cngb3 UTSW 4 19375231 missense probably benign 0.01
R7070:Cngb3 UTSW 4 19425593 missense possibly damaging 0.78
R7316:Cngb3 UTSW 4 19425599 missense probably benign 0.16
R7371:Cngb3 UTSW 4 19425575 missense possibly damaging 0.69
R7554:Cngb3 UTSW 4 19461753 nonsense probably null
R7755:Cngb3 UTSW 4 19461684 missense probably benign 0.01
R8004:Cngb3 UTSW 4 19505273 missense possibly damaging 0.85
R8025:Cngb3 UTSW 4 19280960 missense possibly damaging 0.95
X0062:Cngb3 UTSW 4 19364189 missense possibly damaging 0.91
X0067:Cngb3 UTSW 4 19367753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGATCAAAGCTGATTCGATAG -3'
(R):5'- TGCACATACATCCATGCAAGTC -3'

Sequencing Primer
(F):5'- CGATAGTAAGTTATTCAACAGTCAGG -3'
(R):5'- CCATGCAAGTCACAGTATCTAGTG -3'
Posted On2017-02-28