Mutagenetix > Incidental Mutations

Incidental Mutation 'R5945:Large1'

460553

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

044137-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R5945 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72852200 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 459 (Y459C)

Ref Sequence

ENSEMBL: ENSMUSP00000148336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: Y459C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: Y459C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: Y459C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: Y459C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: Y459C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.8192

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930488N24Rik	T	C	17: 14,106,339		noncoding transcript	Het
Abca13	C	T	11: 9,293,398	H1754Y	probably benign	Het
Abi1	T	C	2: 23,039,965	E34G	probably damaging	Het
Apobec3	C	T	15: 79,897,846	T19I	probably damaging	Het
Arel1	C	A	12: 84,926,347	V559L	probably benign	Het
Arhgef10	T	C	8: 14,980,028		probably null	Het
Asb6	T	C	2: 30,828,203		probably benign	Het
Asxl2	T	C	12: 3,500,439	V727A	possibly damaging	Het
Atp13a5	C	A	16: 29,237,243	R1100L	probably benign	Het
Atp6v1a	A	G	16: 44,099,946	V429A	probably damaging	Het
Caml	A	G	13: 55,628,632	Y228C	probably damaging	Het
Ccdc14	A	G	16: 34,723,588	E772G	probably damaging	Het
Ccdc96	A	G	5: 36,485,850	E400G	probably damaging	Het
Ces1h	T	A	8: 93,363,626	E266V	probably benign	Het
Chd5	G	T	4: 152,379,951	Q1522H	probably benign	Het
CN725425	T	A	15: 91,245,777	I281N	possibly damaging	Het
Cngb3	A	T	4: 19,283,579	E62V	probably null	Het
Cops5	T	A	1: 10,038,010		probably benign	Het
Crhr2	T	A	6: 55,100,682	I232F	possibly damaging	Het
Cxcl3	C	T	5: 90,786,316		probably benign	Het
Ddx31	T	A	2: 28,859,890	I308N	probably damaging	Het
Efcab14	T	A	4: 115,756,467	V204D	probably damaging	Het
Emsy	T	C	7: 98,619,383	T484A	probably damaging	Het
Ep400	A	T	5: 110,682,866	I2257N	unknown	Het
Epb41l4a	T	A	18: 33,828,730	Q420L	possibly damaging	Het
Fat4	A	G	3: 38,983,206	D3669G	probably benign	Het
Fmnl2	C	A	2: 53,114,199	T607K	probably damaging	Het
Glod4	T	C	11: 76,234,471	Y135C	probably damaging	Het
Gm10912	A	G	2: 104,066,616	I33M	possibly damaging	Het
Gm5592	T	C	7: 41,215,612		probably benign	Het
Gm6614	T	A	6: 141,994,282	N145I	probably damaging	Het
Gria4	A	G	9: 4,456,122	L726P	probably damaging	Het
H2-M10.4	T	C	17: 36,460,626	E220G	probably benign	Het
Itga1	T	G	13: 114,966,590	N1102H	probably benign	Het
Itpk1	A	G	12: 102,588,553	I6T	probably damaging	Het
Kcnh4	T	C	11: 100,745,322	D833G	probably damaging	Het
Kdm1a	T	C	4: 136,568,701		probably null	Het
Kif24	G	A	4: 41,428,670	Q97*	probably null	Het
Klhl2	T	C	8: 64,749,728	I479V	probably benign	Het
Lcn8	T	G	2: 25,655,497	L169R	probably damaging	Het
Loxl3	T	G	6: 83,037,511	S133R	probably damaging	Het
Lyzl4	A	G	9: 121,584,463	Y4H	unknown	Het
March7	A	G	2: 60,240,987	K612E	probably damaging	Het
Mreg	C	T	1: 72,192,200	G33D	probably benign	Het
Ms4a6c	A	C	19: 11,480,499		probably benign	Het
Nrbf2	G	A	10: 67,267,520	S268F	possibly damaging	Het
Olfr1157	A	T	2: 87,962,602	C97S	probably damaging	Het
Olfr196	A	G	16: 59,168,119	L8P	probably benign	Het
Olfr197	C	T	16: 59,185,728	V252I	unknown	Het
Olfr729	A	G	14: 50,148,763	V37A	probably benign	Het
Oog4	T	A	4: 143,437,723	I341F	probably benign	Het
Pcdhb5	G	A	18: 37,321,470	R301Q	probably benign	Het
Podn	T	C	4: 108,021,713	K174R	possibly damaging	Het
Pphln1	T	C	15: 93,455,532		probably null	Het
Ppp2r1a	C	G	17: 20,959,413	H112D	possibly damaging	Het
Prmt5	A	G	14: 54,514,887	F151L	possibly damaging	Het
Ptch1	A	T	13: 63,573,419		probably benign	Het
Rgl2	A	G	17: 33,932,038		probably null	Het
Ryr2	A	T	13: 11,660,122	I3373N	probably damaging	Het
Scap	A	G	9: 110,384,596	N1209S	probably benign	Het
Sin3b	T	C	8: 72,731,165	S170P	probably damaging	Het
Slc22a4	A	T	11: 53,996,028	I296N	probably damaging	Het
Slco2a1	T	C	9: 103,046,790	S68P	probably damaging	Het
Snx8	A	G	5: 140,353,480	C161R	probably benign	Het
Spryd3	C	T	15: 102,118,195	C347Y	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Strn3	T	C	12: 51,629,496	T333A	probably benign	Het
Swt1	T	A	1: 151,411,170	E190D	probably benign	Het
Tchh	A	T	3: 93,445,337	I695F	unknown	Het
Tfap4	G	A	16: 4,545,629	S314L	possibly damaging	Het
Tigd3	G	T	19: 5,891,866	T412K	probably benign	Het
Tmem184b	T	A	15: 79,365,481		probably null	Het
Trpa1	T	C	1: 14,898,135	D469G	probably benign	Het
Tssk1	T	C	16: 17,894,701	F117L	probably damaging	Het
Tuba3b	T	A	6: 145,619,745	M313K	probably damaging	Het
Tubgcp6	T	C	15: 89,109,217		probably null	Het
Vav1	A	G	17: 57,301,870	K345E	possibly damaging	Het
Zdhhc4	G	A	5: 143,324,886	R64C	probably damaging	Het
Zfp280d	T	A	9: 72,362,332	L892*	probably null	Het
Zfp46	T	A	4: 136,287,217	M3K	probably damaging	Het
Zfp607b	C	A	7: 27,702,416	P99Q	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp990	T	A	4: 145,538,043	I537N	probably damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAGCACTGGAGATGAGAC -3'
(R):5'- AAGTCCTTTCTGTTGAACCACC -3'

Sequencing Primer
(F):5'- CTGAGATCAACCTCAAGTGTACTAG -3'
(R):5'- TTTCTGTTGAACCACCAGCAAGG -3'

Posted On

2017-02-28