Incidental Mutation 'R5945:Strn3'
ID460567
Institutional Source Beutler Lab
Gene Symbol Strn3
Ensembl Gene ENSMUSG00000020954
Gene Namestriatin, calmodulin binding protein 3
SynonymsSG2NA
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5945 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51609632-51691897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51629496 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 333 (T333A)
Ref Sequence ENSEMBL: ENSMUSP00000130184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013130] [ENSMUST00000169503]
Predicted Effect probably benign
Transcript: ENSMUST00000013130
AA Change: T417A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000013130
Gene: ENSMUSG00000020954
AA Change: T417A

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 194 1.3e-50 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
WD40 468 507 7.05e-9 SMART
WD40 521 560 2.42e-7 SMART
WD40 574 613 1.62e-8 SMART
WD40 617 659 8.25e0 SMART
WD40 670 708 2.65e1 SMART
WD40 711 750 2.32e-9 SMART
WD40 753 796 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169503
AA Change: T333A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130184
Gene: ENSMUSG00000020954
AA Change: T333A

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 198 3.2e-51 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
WD40 384 423 7.05e-9 SMART
WD40 437 476 2.42e-7 SMART
WD40 490 529 1.62e-8 SMART
WD40 533 575 8.25e0 SMART
WD40 586 624 2.65e1 SMART
WD40 627 666 2.32e-9 SMART
WD40 669 712 4.95e-4 SMART
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc14 A G 16: 34,723,588 E772G probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 E62V probably null Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Epb41l4a T A 18: 33,828,730 Q420L possibly damaging Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Olfr729 A G 14: 50,148,763 V37A probably benign Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Ptch1 A T 13: 63,573,419 probably benign Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Strn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Strn3 APN 12 51661196 missense possibly damaging 0.63
IGL00690:Strn3 APN 12 51610438 missense possibly damaging 0.96
IGL00886:Strn3 APN 12 51610150 missense probably damaging 1.00
IGL01967:Strn3 APN 12 51652813 missense probably damaging 1.00
IGL02507:Strn3 APN 12 51661627 nonsense probably null
IGL03139:Strn3 APN 12 51652850 splice site probably benign
IGL03282:Strn3 APN 12 51627209 missense probably benign 0.00
PIT4519001:Strn3 UTSW 12 51633708 missense probably benign 0.00
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0336:Strn3 UTSW 12 51661608 critical splice donor site probably null
R0492:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0512:Strn3 UTSW 12 51627183 missense possibly damaging 0.94
R0610:Strn3 UTSW 12 51610448 critical splice acceptor site probably null
R0707:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0834:Strn3 UTSW 12 51627096 splice site probably benign
R1562:Strn3 UTSW 12 51633618 missense probably benign
R1599:Strn3 UTSW 12 51652766 missense possibly damaging 0.78
R1663:Strn3 UTSW 12 51652826 missense probably damaging 1.00
R1807:Strn3 UTSW 12 51627203 missense probably benign 0.10
R2263:Strn3 UTSW 12 51643223 splice site probably null
R2443:Strn3 UTSW 12 51627835 missense probably damaging 1.00
R3623:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R3624:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R4154:Strn3 UTSW 12 51627131 missense probably damaging 1.00
R4223:Strn3 UTSW 12 51627855 missense probably damaging 1.00
R4400:Strn3 UTSW 12 51648100 missense possibly damaging 0.85
R4564:Strn3 UTSW 12 51633621 missense probably benign 0.00
R4585:Strn3 UTSW 12 51650170 missense probably benign 0.02
R4755:Strn3 UTSW 12 51610216 missense possibly damaging 0.70
R4794:Strn3 UTSW 12 51650171 missense probably benign 0.38
R5288:Strn3 UTSW 12 51648020 missense probably damaging 1.00
R5308:Strn3 UTSW 12 51629385 missense probably damaging 0.99
R5765:Strn3 UTSW 12 51633627 missense probably benign
R5893:Strn3 UTSW 12 51643223 splice site probably null
R6244:Strn3 UTSW 12 51610107 missense probably damaging 0.98
R6523:Strn3 UTSW 12 51643098 unclassified probably null
R7437:Strn3 UTSW 12 51610163 missense probably damaging 1.00
R7545:Strn3 UTSW 12 51627760 missense probably damaging 0.98
X0024:Strn3 UTSW 12 51652709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTCCAAAGAATAAGGAGCCTTC -3'
(R):5'- GTGTTCAGTCTCCACTCTAGG -3'

Sequencing Primer
(F):5'- GTCAAGTCTGCAAGGTCT -3'
(R):5'- GTCTCCACTCTAGGATAATATATAC -3'
Posted On2017-02-28