Mutagenetix > Incidental Mutation

Incidental Mutation 'R5945:Ptch1'

460572

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

044137-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5945 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

utr 5 prime

DNA Base Change (assembly)

A to T at 63573419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000194663] [ENSMUST00000195106]

AlphaFold

Q61115

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000195106
AA Change: V12E

SMART Domains

Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466
AA Change: V12E

Domain	Start	End	E-Value	Type
low complexity region	38	59	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220498

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222732

Meta Mutation Damage Score

0.1105

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930488N24Rik	T	C	17: 14,106,339		noncoding transcript	Het
Abca13	C	T	11: 9,293,398	H1754Y	probably benign	Het
Abi1	T	C	2: 23,039,965	E34G	probably damaging	Het
Apobec3	C	T	15: 79,897,846	T19I	probably damaging	Het
Arel1	C	A	12: 84,926,347	V559L	probably benign	Het
Arhgef10	T	C	8: 14,980,028		probably null	Het
Asb6	T	C	2: 30,828,203		probably benign	Het
Asxl2	T	C	12: 3,500,439	V727A	possibly damaging	Het
Atp13a5	C	A	16: 29,237,243	R1100L	probably benign	Het
Atp6v1a	A	G	16: 44,099,946	V429A	probably damaging	Het
Caml	A	G	13: 55,628,632	Y228C	probably damaging	Het
Ccdc14	A	G	16: 34,723,588	E772G	probably damaging	Het
Ccdc96	A	G	5: 36,485,850	E400G	probably damaging	Het
Ces1h	T	A	8: 93,363,626	E266V	probably benign	Het
Chd5	G	T	4: 152,379,951	Q1522H	probably benign	Het
CN725425	T	A	15: 91,245,777	I281N	possibly damaging	Het
Cngb3	A	T	4: 19,283,579	E62V	probably null	Het
Cops5	T	A	1: 10,038,010		probably benign	Het
Crhr2	T	A	6: 55,100,682	I232F	possibly damaging	Het
Cxcl3	C	T	5: 90,786,316		probably benign	Het
Ddx31	T	A	2: 28,859,890	I308N	probably damaging	Het
Efcab14	T	A	4: 115,756,467	V204D	probably damaging	Het
Emsy	T	C	7: 98,619,383	T484A	probably damaging	Het
Ep400	A	T	5: 110,682,866	I2257N	unknown	Het
Epb41l4a	T	A	18: 33,828,730	Q420L	possibly damaging	Het
Fat4	A	G	3: 38,983,206	D3669G	probably benign	Het
Fmnl2	C	A	2: 53,114,199	T607K	probably damaging	Het
Glod4	T	C	11: 76,234,471	Y135C	probably damaging	Het
Gm10912	A	G	2: 104,066,616	I33M	possibly damaging	Het
Gm5592	T	C	7: 41,215,612		probably benign	Het
Gm6614	T	A	6: 141,994,282	N145I	probably damaging	Het
Gria4	A	G	9: 4,456,122	L726P	probably damaging	Het
H2-M10.4	T	C	17: 36,460,626	E220G	probably benign	Het
Itga1	T	G	13: 114,966,590	N1102H	probably benign	Het
Itpk1	A	G	12: 102,588,553	I6T	probably damaging	Het
Kcnh4	T	C	11: 100,745,322	D833G	probably damaging	Het
Kdm1a	T	C	4: 136,568,701		probably null	Het
Kif24	G	A	4: 41,428,670	Q97*	probably null	Het
Klhl2	T	C	8: 64,749,728	I479V	probably benign	Het
Large1	T	C	8: 72,852,200	Y459C	probably damaging	Het
Lcn8	T	G	2: 25,655,497	L169R	probably damaging	Het
Loxl3	T	G	6: 83,037,511	S133R	probably damaging	Het
Lyzl4	A	G	9: 121,584,463	Y4H	unknown	Het
March7	A	G	2: 60,240,987	K612E	probably damaging	Het
Mreg	C	T	1: 72,192,200	G33D	probably benign	Het
Ms4a6c	A	C	19: 11,480,499		probably benign	Het
Nrbf2	G	A	10: 67,267,520	S268F	possibly damaging	Het
Olfr1157	A	T	2: 87,962,602	C97S	probably damaging	Het
Olfr196	A	G	16: 59,168,119	L8P	probably benign	Het
Olfr197	C	T	16: 59,185,728	V252I	unknown	Het
Olfr729	A	G	14: 50,148,763	V37A	probably benign	Het
Oog4	T	A	4: 143,437,723	I341F	probably benign	Het
Pcdhb5	G	A	18: 37,321,470	R301Q	probably benign	Het
Podn	T	C	4: 108,021,713	K174R	possibly damaging	Het
Pphln1	T	C	15: 93,455,532		probably null	Het
Ppp2r1a	C	G	17: 20,959,413	H112D	possibly damaging	Het
Prmt5	A	G	14: 54,514,887	F151L	possibly damaging	Het
Rgl2	A	G	17: 33,932,038		probably null	Het
Ryr2	A	T	13: 11,660,122	I3373N	probably damaging	Het
Scap	A	G	9: 110,384,596	N1209S	probably benign	Het
Sin3b	T	C	8: 72,731,165	S170P	probably damaging	Het
Slc22a4	A	T	11: 53,996,028	I296N	probably damaging	Het
Slco2a1	T	C	9: 103,046,790	S68P	probably damaging	Het
Snx8	A	G	5: 140,353,480	C161R	probably benign	Het
Spryd3	C	T	15: 102,118,195	C347Y	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Strn3	T	C	12: 51,629,496	T333A	probably benign	Het
Swt1	T	A	1: 151,411,170	E190D	probably benign	Het
Tchh	A	T	3: 93,445,337	I695F	unknown	Het
Tfap4	G	A	16: 4,545,629	S314L	possibly damaging	Het
Tigd3	G	T	19: 5,891,866	T412K	probably benign	Het
Tmem184b	T	A	15: 79,365,481		probably null	Het
Trpa1	T	C	1: 14,898,135	D469G	probably benign	Het
Tssk1	T	C	16: 17,894,701	F117L	probably damaging	Het
Tuba3b	T	A	6: 145,619,745	M313K	probably damaging	Het
Tubgcp6	T	C	15: 89,109,217		probably null	Het
Vav1	A	G	17: 57,301,870	K345E	possibly damaging	Het
Zdhhc4	G	A	5: 143,324,886	R64C	probably damaging	Het
Zfp280d	T	A	9: 72,362,332	L892*	probably null	Het
Zfp46	T	A	4: 136,287,217	M3K	probably damaging	Het
Zfp607b	C	A	7: 27,702,416	P99Q	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp990	T	A	4: 145,538,043	I537N	probably damaging	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6358:Ptch1	UTSW	13	63513689	missense	probably damaging	0.96
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TATTAATTTCCCGGGGCCCC -3'
(R):5'- AAAGGAAGGCAGCTACTCTG -3'

Sequencing Primer
(F):5'- GTGCTGCGTGGCTCTCTC -3'
(R):5'- AGGGCAGCCTGTTTACCCAG -3'

Posted On

2017-02-28