Incidental Mutation 'R5945:Ptch1'
ID460572
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5945 (G1)
Quality Score212
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 63573419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000194663] [ENSMUST00000195106]
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000195106
AA Change: V12E
SMART Domains Protein: ENSMUSP00000141298
Gene: ENSMUSG00000021466
AA Change: V12E

DomainStartEndE-ValueType
low complexity region 38 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222732
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc14 A G 16: 34,723,588 E772G probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 E62V probably null Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Epb41l4a T A 18: 33,828,730 Q420L possibly damaging Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Olfr729 A G 14: 50,148,763 V37A probably benign Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Strn3 T C 12: 51,629,496 T333A probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4035:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63540812 missense probably damaging 0.98
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTAATTTCCCGGGGCCCC -3'
(R):5'- AAAGGAAGGCAGCTACTCTG -3'

Sequencing Primer
(F):5'- GTGCTGCGTGGCTCTCTC -3'
(R):5'- AGGGCAGCCTGTTTACCCAG -3'
Posted On2017-02-28