Incidental Mutation 'R5945:Olfr729'
ID460574
Institutional Source Beutler Lab
Gene Symbol Olfr729
Ensembl Gene ENSMUSG00000049011
Gene Nameolfactory receptor 729
SynonymsMOR246-6, GA_x6K02T2PMLR-5839874-5838903
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5945 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50144731-50152910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50148763 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000149189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061020] [ENSMUST00000213163] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect probably benign
Transcript: ENSMUST00000061020
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051755
Gene: ENSMUSG00000049011
AA Change: V37A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.4e-5 PFAM
Pfam:7tm_1 41 287 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213163
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215327
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215451
AA Change: V37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0813 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc14 A G 16: 34,723,588 E772G probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 E62V probably null Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Epb41l4a T A 18: 33,828,730 Q420L possibly damaging Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Ptch1 A T 13: 63,573,419 probably benign Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Strn3 T C 12: 51,629,496 T333A probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Olfr729
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Olfr729 APN 14 50148716 missense probably benign 0.38
IGL02736:Olfr729 APN 14 50148424 missense probably benign 0.01
IGL02798:Olfr729 APN 14 50148378 missense probably benign
IGL03267:Olfr729 APN 14 50148847 missense probably damaging 1.00
R0082:Olfr729 UTSW 14 50148055 missense probably damaging 0.97
R0225:Olfr729 UTSW 14 50148635 missense probably damaging 1.00
R0503:Olfr729 UTSW 14 50148478 missense probably damaging 1.00
R1022:Olfr729 UTSW 14 50147927 missense probably benign
R1024:Olfr729 UTSW 14 50147927 missense probably benign
R1424:Olfr729 UTSW 14 50148465 missense possibly damaging 0.83
R1440:Olfr729 UTSW 14 50148358 missense probably damaging 1.00
R1479:Olfr729 UTSW 14 50148788 missense probably benign 0.00
R1583:Olfr729 UTSW 14 50148774 missense probably benign 0.00
R1817:Olfr729 UTSW 14 50148271 missense probably benign 0.00
R2155:Olfr729 UTSW 14 50148697 missense probably damaging 1.00
R2282:Olfr729 UTSW 14 50148319 missense probably benign
R2926:Olfr729 UTSW 14 50148436 missense probably benign 0.19
R3790:Olfr729 UTSW 14 50148569 missense possibly damaging 0.51
R4073:Olfr729 UTSW 14 50148043 missense possibly damaging 0.55
R6714:Olfr729 UTSW 14 50148214 missense possibly damaging 0.95
R7112:Olfr729 UTSW 14 50147935 missense probably benign 0.00
R7157:Olfr729 UTSW 14 50148232 missense probably damaging 1.00
R7511:Olfr729 UTSW 14 50148256 missense probably damaging 1.00
R7815:Olfr729 UTSW 14 50148796 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GCAGCCACTGAATGATATAGTCTTG -3'
(R):5'- TCAAGATGTCTCAGAGTCCTTTGC -3'

Sequencing Primer
(F):5'- GTCTTGTGTTCACTCAGAAAGTC -3'
(R):5'- TAGTGCAAATCTGTGCCC -3'
Posted On2017-02-28