Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Mib2'

46058

Institutional Source

Beutler Lab

Gene Symbol

Mib2

Ensembl Gene

ENSMUSG00000029060

Gene Name

mindbomb E3 ubiquitin protein ligase 2

Synonyms

2210008I11Rik, Zzank1

MMRRC Submission

038755-MU

Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0564 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

155654677-155669198 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 155659460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 42 (G42S)

Ref Sequence

ENSEMBL: ENSMUSP00000122269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103176] [ENSMUST00000141108]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103176
AA Change: G217S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: G217S

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	12	78	3.4e-26	PFAM
ZnF_ZZ	85	130	6.44e-9	SMART
Pfam:MIB_HERC2	160	225	4.2e-26	PFAM
Blast:ANK	285	320	2e-13	BLAST
ANK	428	457	8.52e-4	SMART
ANK	461	490	6.71e-2	SMART
ANK	494	523	9.93e-5	SMART
ANK	527	559	1.1e2	SMART
ANK	563	593	9.21e0	SMART
ANK	597	627	3.57e-6	SMART
ANK	631	660	3.31e-1	SMART
ANK	664	709	1.73e3	SMART
Blast:ANK	733	762	9e-10	BLAST
low complexity region	763	772	N/A	INTRINSIC
RING	798	832	2.55e-1	SMART
RING	877	909	1.81e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128204

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130237

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139134

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139788

Predicted Effect

probably damaging
Transcript: ENSMUST00000141108
AA Change: G42S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060
AA Change: G42S

Domain	Start	End	E-Value	Type
Pfam:MIB_HERC2	1	52	7.1e-17	PFAM
internal_repeat_1	82	150	7.77e-12	PROSPERO
internal_repeat_1	153	220	7.77e-12	PROSPERO
ANK	289	318	8.52e-4	SMART
ANK	322	351	6.71e-2	SMART
Pfam:Ank	356	375	2.9e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151843

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155189

Meta Mutation Damage Score

0.6007

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

MGI Phenotype

Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Col6a3	A	C	1: 90,807,734	V731G	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Esf1	A	T	2: 140,158,586	Y427N	possibly damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mpp3	T	G	11: 102,005,347	K450T	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sema3e	T	A	5: 14,236,085		probably null	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Trio	T	C	15: 27,805,822	N527D	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Mib2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Mib2	APN	4	155657730	missense	probably damaging	1.00
IGL01404:Mib2	APN	4	155654936	missense	probably damaging	1.00
IGL01819:Mib2	APN	4	155655258	splice site	probably null
IGL02147:Mib2	APN	4	155657687	missense	probably benign
IGL02260:Mib2	APN	4	155661171	missense	probably damaging	1.00
IGL02472:Mib2	APN	4	155656746	missense	probably damaging	1.00
IGL02632:Mib2	APN	4	155655579	missense	probably damaging	0.98
IGL03051:Mib2	APN	4	155657290	missense	probably damaging	1.00
IGL03077:Mib2	APN	4	155659443	missense	probably benign	0.01
R0042:Mib2	UTSW	4	155659440	nonsense	probably null
R0042:Mib2	UTSW	4	155659440	nonsense	probably null
R0115:Mib2	UTSW	4	155656062	unclassified	probably benign
R0193:Mib2	UTSW	4	155655673	missense	probably benign
R0279:Mib2	UTSW	4	155661216	missense	possibly damaging	0.89
R0373:Mib2	UTSW	4	155656288	missense	probably damaging	1.00
R0481:Mib2	UTSW	4	155656062	unclassified	probably benign
R0563:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0625:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0714:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0740:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0942:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R0987:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1023:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1033:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1037:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1460:Mib2	UTSW	4	155659460	missense	probably damaging	1.00
R1481:Mib2	UTSW	4	155656999	missense	probably benign	0.01
R1712:Mib2	UTSW	4	155654799	missense	probably damaging	1.00
R2015:Mib2	UTSW	4	155657880	missense	probably damaging	1.00
R2072:Mib2	UTSW	4	155659701	missense	probably damaging	0.99
R2131:Mib2	UTSW	4	155655238	splice site	probably null
R2187:Mib2	UTSW	4	155654933	missense	possibly damaging	0.95
R3751:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R3752:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R3753:Mib2	UTSW	4	155655284	missense	probably damaging	1.00
R4381:Mib2	UTSW	4	155657612	missense	possibly damaging	0.55
R4584:Mib2	UTSW	4	155657287	missense	probably damaging	1.00
R4669:Mib2	UTSW	4	155657415	missense	possibly damaging	0.49
R4754:Mib2	UTSW	4	155655365	missense	possibly damaging	0.90
R4782:Mib2	UTSW	4	155659772	missense	probably benign	0.00
R4799:Mib2	UTSW	4	155659772	missense	probably benign	0.00
R5036:Mib2	UTSW	4	155656288	missense	probably damaging	1.00
R5073:Mib2	UTSW	4	155656776	missense	probably damaging	1.00
R5915:Mib2	UTSW	4	155656051	unclassified	probably benign
R6695:Mib2	UTSW	4	155661172	missense	probably damaging	1.00
R7039:Mib2	UTSW	4	155659701	missense	probably damaging	0.99
R7234:Mib2	UTSW	4	155657893	missense	probably damaging	1.00
R7582:Mib2	UTSW	4	155654810	missense	probably benign
R8133:Mib2	UTSW	4	155657001	missense	probably benign	0.00
R8704:Mib2	UTSW	4	155659163	missense	possibly damaging	0.93
R8904:Mib2	UTSW	4	155659716	missense	probably damaging	0.99
R8987:Mib2	UTSW	4	155660894	missense	probably benign	0.01
R8988:Mib2	UTSW	4	155656272	missense	possibly damaging	0.47
R9336:Mib2	UTSW	4	155658937	missense	probably benign
R9537:Mib2	UTSW	4	155657495	missense	probably damaging	1.00
R9640:Mib2	UTSW	4	155660868	missense	possibly damaging	0.77
X0012:Mib2	UTSW	4	155655395	splice site	probably null
Z1176:Mib2	UTSW	4	155661141	missense	probably benign	0.06
Z1177:Mib2	UTSW	4	155655521	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAACAGGACATGCTAGGGTGAC -3'
(R):5'- GAGGGGCATCTTTCAAGGAGCTAAG -3'

Sequencing Primer
(F):5'- CATGCTAGGGTGACACGGG -3'
(R):5'- TTTCAAGGAGCTAAGGTGGTACG -3'

Posted On

2013-06-11