Incidental Mutation 'R0564:Mib2'
ID46058
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
MMRRC Submission 038755-MU
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0564 (G1)
Quality Score204
Status Validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155659460 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 42 (G42S)
Ref Sequence ENSEMBL: ENSMUSP00000122269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103176] [ENSMUST00000141108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103176
AA Change: G217S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: G217S

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably damaging
Transcript: ENSMUST00000141108
AA Change: G42S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060
AA Change: G42S

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155189
Meta Mutation Damage Score 0.6007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Ankib1 A G 5: 3,729,655 Y405H probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 unclassified probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0481:Mib2 UTSW 4 155656062 unclassified probably benign
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2015:Mib2 UTSW 4 155657880 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 unclassified probably null
R2187:Mib2 UTSW 4 155654933 missense possibly damaging 0.95
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3753:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7039:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
R7582:Mib2 UTSW 4 155654810 missense probably benign
X0012:Mib2 UTSW 4 155655395 unclassified probably null
Z1176:Mib2 UTSW 4 155661141 missense probably benign 0.06
Z1177:Mib2 UTSW 4 155655521 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAACAGGACATGCTAGGGTGAC -3'
(R):5'- GAGGGGCATCTTTCAAGGAGCTAAG -3'

Sequencing Primer
(F):5'- CATGCTAGGGTGACACGGG -3'
(R):5'- TTTCAAGGAGCTAAGGTGGTACG -3'
Posted On2013-06-11