Incidental Mutation 'R5945:Ccdc14'
ID460585
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Namecoiled-coil domain containing 14
Synonyms
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5945 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34690616-34725202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34723588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 772 (E772G)
Ref Sequence ENSEMBL: ENSMUSP00000156124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
Predicted Effect probably damaging
Transcript: ENSMUST00000023532
AA Change: E820G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: E820G

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231364
Predicted Effect probably damaging
Transcript: ENSMUST00000231609
AA Change: E772G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 E62V probably null Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Epb41l4a T A 18: 33,828,730 Q420L possibly damaging Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Olfr729 A G 14: 50,148,763 V37A probably benign Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Ptch1 A T 13: 63,573,419 probably benign Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Strn3 T C 12: 51,629,496 T333A probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2337:Ccdc14 UTSW 16 34705018 missense probably benign 0.04
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4645:Ccdc14 UTSW 16 34721740 missense probably damaging 1.00
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5319:Ccdc14 UTSW 16 34723172 missense probably damaging 0.99
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6662:Ccdc14 UTSW 16 34690794 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- ATGGGTGTAACGTGGACAGTAC -3'
(R):5'- TTGAGAAAGCTGCTGTCAGG -3'

Sequencing Primer
(F):5'- ACGTGGACAGTACAGTTTATATCCCC -3'
(R):5'- GCTGCTGTCAGGAACAATACTGC -3'
Posted On2017-02-28