Incidental Mutation 'R5945:Epb41l4a'
ID460594
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission 044137-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5945 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33828730 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 420 (Q420L)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025234
AA Change: Q420L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: Q420L

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Meta Mutation Damage Score 0.1309 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,106,339 noncoding transcript Het
Abca13 C T 11: 9,293,398 H1754Y probably benign Het
Abi1 T C 2: 23,039,965 E34G probably damaging Het
Apobec3 C T 15: 79,897,846 T19I probably damaging Het
Arel1 C A 12: 84,926,347 V559L probably benign Het
Arhgef10 T C 8: 14,980,028 probably null Het
Asb6 T C 2: 30,828,203 probably benign Het
Asxl2 T C 12: 3,500,439 V727A possibly damaging Het
Atp13a5 C A 16: 29,237,243 R1100L probably benign Het
Atp6v1a A G 16: 44,099,946 V429A probably damaging Het
Caml A G 13: 55,628,632 Y228C probably damaging Het
Ccdc14 A G 16: 34,723,588 E772G probably damaging Het
Ccdc96 A G 5: 36,485,850 E400G probably damaging Het
Ces1h T A 8: 93,363,626 E266V probably benign Het
Chd5 G T 4: 152,379,951 Q1522H probably benign Het
CN725425 T A 15: 91,245,777 I281N possibly damaging Het
Cngb3 A T 4: 19,283,579 E62V probably null Het
Cops5 T A 1: 10,038,010 probably benign Het
Crhr2 T A 6: 55,100,682 I232F possibly damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Ddx31 T A 2: 28,859,890 I308N probably damaging Het
Efcab14 T A 4: 115,756,467 V204D probably damaging Het
Emsy T C 7: 98,619,383 T484A probably damaging Het
Ep400 A T 5: 110,682,866 I2257N unknown Het
Fat4 A G 3: 38,983,206 D3669G probably benign Het
Fmnl2 C A 2: 53,114,199 T607K probably damaging Het
Glod4 T C 11: 76,234,471 Y135C probably damaging Het
Gm10912 A G 2: 104,066,616 I33M possibly damaging Het
Gm5592 T C 7: 41,215,612 probably benign Het
Gm6614 T A 6: 141,994,282 N145I probably damaging Het
Gria4 A G 9: 4,456,122 L726P probably damaging Het
H2-M10.4 T C 17: 36,460,626 E220G probably benign Het
Itga1 T G 13: 114,966,590 N1102H probably benign Het
Itpk1 A G 12: 102,588,553 I6T probably damaging Het
Kcnh4 T C 11: 100,745,322 D833G probably damaging Het
Kdm1a T C 4: 136,568,701 probably null Het
Kif24 G A 4: 41,428,670 Q97* probably null Het
Klhl2 T C 8: 64,749,728 I479V probably benign Het
Large1 T C 8: 72,852,200 Y459C probably damaging Het
Lcn8 T G 2: 25,655,497 L169R probably damaging Het
Loxl3 T G 6: 83,037,511 S133R probably damaging Het
Lyzl4 A G 9: 121,584,463 Y4H unknown Het
March7 A G 2: 60,240,987 K612E probably damaging Het
Mreg C T 1: 72,192,200 G33D probably benign Het
Ms4a6c A C 19: 11,480,499 probably benign Het
Nrbf2 G A 10: 67,267,520 S268F possibly damaging Het
Olfr1157 A T 2: 87,962,602 C97S probably damaging Het
Olfr196 A G 16: 59,168,119 L8P probably benign Het
Olfr197 C T 16: 59,185,728 V252I unknown Het
Olfr729 A G 14: 50,148,763 V37A probably benign Het
Oog4 T A 4: 143,437,723 I341F probably benign Het
Pcdhb5 G A 18: 37,321,470 R301Q probably benign Het
Podn T C 4: 108,021,713 K174R possibly damaging Het
Pphln1 T C 15: 93,455,532 probably null Het
Ppp2r1a C G 17: 20,959,413 H112D possibly damaging Het
Prmt5 A G 14: 54,514,887 F151L possibly damaging Het
Ptch1 A T 13: 63,573,419 probably benign Het
Rgl2 A G 17: 33,932,038 probably null Het
Ryr2 A T 13: 11,660,122 I3373N probably damaging Het
Scap A G 9: 110,384,596 N1209S probably benign Het
Sin3b T C 8: 72,731,165 S170P probably damaging Het
Slc22a4 A T 11: 53,996,028 I296N probably damaging Het
Slco2a1 T C 9: 103,046,790 S68P probably damaging Het
Snx8 A G 5: 140,353,480 C161R probably benign Het
Spryd3 C T 15: 102,118,195 C347Y probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Strn3 T C 12: 51,629,496 T333A probably benign Het
Swt1 T A 1: 151,411,170 E190D probably benign Het
Tchh A T 3: 93,445,337 I695F unknown Het
Tfap4 G A 16: 4,545,629 S314L possibly damaging Het
Tigd3 G T 19: 5,891,866 T412K probably benign Het
Tmem184b T A 15: 79,365,481 probably null Het
Trpa1 T C 1: 14,898,135 D469G probably benign Het
Tssk1 T C 16: 17,894,701 F117L probably damaging Het
Tuba3b T A 6: 145,619,745 M313K probably damaging Het
Tubgcp6 T C 15: 89,109,217 probably null Het
Vav1 A G 17: 57,301,870 K345E possibly damaging Het
Zdhhc4 G A 5: 143,324,886 R64C probably damaging Het
Zfp280d T A 9: 72,362,332 L892* probably null Het
Zfp46 T A 4: 136,287,217 M3K probably damaging Het
Zfp607b C A 7: 27,702,416 P99Q probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp990 T A 4: 145,538,043 I537N probably damaging Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAGGTGGTTTCTTTATACACACTGG -3'
(R):5'- TTCGGAAGGAGTCACAACTG -3'

Sequencing Primer
(F):5'- GTTTTCCTTTCTGTCACACTAAAAGG -3'
(R):5'- AGTCACAACTGTAAGCACGG -3'
Posted On2017-02-28