Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Sema3e'

46060

Institutional Source

Beutler Lab

Gene Symbol

Sema3e

Ensembl Gene

ENSMUSG00000063531

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E

Synonyms

Semah

MMRRC Submission

038755-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.598) question?

Stock #

R0564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14025276-14256689 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 14236085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000073612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073957]

AlphaFold

P70275

Predicted Effect

probably null
Transcript: ENSMUST00000073957

SMART Domains

Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Sema	58	500	1.85e-194	SMART
PSI	518	573	1.81e-10	SMART
IG	587	673	5.75e-4	SMART
low complexity region	737	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199698

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Col6a3	A	C	1: 90,807,734	V731G	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Esf1	A	T	2: 140,158,586	Y427N	possibly damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mpp3	T	G	11: 102,005,347	K450T	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Trio	T	C	15: 27,805,822	N527D	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Sema3e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Sema3e	APN	5	14240572	missense	probably damaging	1.00
IGL01068:Sema3e	APN	5	14233718	critical splice donor site	probably null
IGL01128:Sema3e	APN	5	14232115	missense	probably damaging	1.00
IGL01134:Sema3e	APN	5	14252770	missense	probably damaging	1.00
IGL02013:Sema3e	APN	5	14230193	missense	probably damaging	1.00
IGL02051:Sema3e	APN	5	14224310	missense	possibly damaging	0.77
IGL02309:Sema3e	APN	5	14224390	missense	probably damaging	0.98
IGL02636:Sema3e	APN	5	14225656	missense	probably benign
IGL02702:Sema3e	APN	5	14233726	splice site	probably benign
IGL03001:Sema3e	APN	5	14241043	missense	probably benign	0.19
R0011:Sema3e	UTSW	5	14144011	nonsense	probably null
R0098:Sema3e	UTSW	5	14252432	missense	possibly damaging	0.52
R0098:Sema3e	UTSW	5	14252432	missense	possibly damaging	0.52
R0220:Sema3e	UTSW	5	14164153	missense	possibly damaging	0.56
R1079:Sema3e	UTSW	5	14225655	missense	probably benign	0.12
R1187:Sema3e	UTSW	5	14232084	missense	probably damaging	1.00
R1670:Sema3e	UTSW	5	14162185	splice site	probably benign
R1736:Sema3e	UTSW	5	14210376	missense	probably damaging	1.00
R3433:Sema3e	UTSW	5	14252714	missense	probably benign	0.00
R3831:Sema3e	UTSW	5	14226482	missense	probably damaging	1.00
R4094:Sema3e	UTSW	5	14233690	missense	probably benign	0.12
R4580:Sema3e	UTSW	5	14233703	missense	probably damaging	1.00
R4828:Sema3e	UTSW	5	14226640	missense	probably damaging	1.00
R4855:Sema3e	UTSW	5	14230130	missense	probably damaging	0.99
R4884:Sema3e	UTSW	5	14225565	missense	probably damaging	1.00
R4960:Sema3e	UTSW	5	14252632	missense	possibly damaging	0.93
R5264:Sema3e	UTSW	5	14226648	missense	probably damaging	1.00
R5389:Sema3e	UTSW	5	14236085	critical splice donor site	probably benign
R5512:Sema3e	UTSW	5	14230180	missense	probably damaging	1.00
R5642:Sema3e	UTSW	5	14162243	missense	probably damaging	1.00
R5647:Sema3e	UTSW	5	14225553	missense	probably damaging	0.99
R5814:Sema3e	UTSW	5	14225666	missense	probably benign	0.01
R5993:Sema3e	UTSW	5	14224293	missense	probably damaging	1.00
R6076:Sema3e	UTSW	5	14241086	missense	probably benign	0.01
R6906:Sema3e	UTSW	5	14240587	missense	probably damaging	1.00
R7432:Sema3e	UTSW	5	14224390	missense	probably damaging	0.98
R8738:Sema3e	UTSW	5	14164155	missense	possibly damaging	0.95
R8849:Sema3e	UTSW	5	14252659	missense	probably damaging	1.00
R8879:Sema3e	UTSW	5	14232094	missense	probably benign	0.16
R8935:Sema3e	UTSW	5	14232113	missense	probably damaging	0.97
R9071:Sema3e	UTSW	5	14232140	missense	probably benign	0.00
R9100:Sema3e	UTSW	5	14232194	missense	probably damaging	1.00
R9367:Sema3e	UTSW	5	14241070	missense	probably benign	0.00
R9444:Sema3e	UTSW	5	14252611	missense	possibly damaging	0.63
R9478:Sema3e	UTSW	5	14236372	missense	probably damaging	1.00
R9601:Sema3e	UTSW	5	14252383	missense	possibly damaging	0.95
R9671:Sema3e	UTSW	5	14162203	missense	probably benign	0.00
X0064:Sema3e	UTSW	5	14230142	missense	probably benign	0.05
Z1088:Sema3e	UTSW	5	14226456	missense	probably damaging	0.97
Z1177:Sema3e	UTSW	5	14025711	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTCATTCCAGTACACACATGCTCC -3'
(R):5'- ATCTGACTTGTGCCACAGCAGAGG -3'

Sequencing Primer
(F):5'- TTACTTCAGAGACCAGGAATAAGCTG -3'
(R):5'- CTGATCCAATGTAAAGCTGTTGC -3'

Posted On

2013-06-11