Incidental Mutation 'R5906:Sec16a'
ID460602
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 044103-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5906 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26438831 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1057 (H1057Q)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091252
AA Change: H1057Q

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: H1057Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114082
AA Change: H1057Q

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: H1057Q

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155252
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
Gm13441 G C 2: 31,887,499 silent Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Kcnt1 A T 2: 25,894,524 probably benign Het
Kcnt1 T C 2: 25,898,401 F336S probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr145 A G 9: 37,897,878 H158R probably damaging Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkd2 A T 5: 104,477,179 probably null Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGCCAAGCTTTCAGACTG -3'
(R):5'- AGTGTGATGCTAGTTCCACCTG -3'

Sequencing Primer
(F):5'- AAGCTTTCAGACTGTCCTTGTG -3'
(R):5'- ACCTGCAAGCAGTACTTTGG -3'
Posted On2017-02-28