Incidental Mutation 'R0564:Apbb2'
ID 46061
Institutional Source Beutler Lab
Gene Symbol Apbb2
Ensembl Gene ENSMUSG00000029207
Gene Name amyloid beta precursor protein binding family B member 2
Synonyms Zfra, TR2L, 2310007D03Rik, Rirl1, FE65L1
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 66456046-66776127 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66609593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 18 (M18K)
Ref Sequence ENSEMBL: ENSMUSP00000124139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087256] [ENSMUST00000159357] [ENSMUST00000159512] [ENSMUST00000159786] [ENSMUST00000160063] [ENSMUST00000160103] [ENSMUST00000160870] [ENSMUST00000162349] [ENSMUST00000161879] [ENSMUST00000162366] [ENSMUST00000162382] [ENSMUST00000162994] [ENSMUST00000161716]
AlphaFold Q9DBR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000087256
AA Change: M18K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084511
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 3.15e-38 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159357
Predicted Effect probably damaging
Transcript: ENSMUST00000159512
AA Change: M18K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124807
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 1.06e-7 SMART
PTB 394 538 2.87e-41 SMART
PTB 565 695 2.5e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159786
AA Change: M18K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125211
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 560 4.29e-40 SMART
PTB 587 717 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160063
AA Change: M18K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123778
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 292 323 6.1e-10 SMART
PTB 415 510 1.3e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160103
AA Change: M18K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000160870
AA Change: M18K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123978
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 564 694 2.5e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162349
AA Change: M18K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123752
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 414 558 2.87e-41 SMART
PTB 585 715 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161879
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000162366
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125116
Gene: ENSMUSG00000029207
AA Change: M18K

DomainStartEndE-ValueType
WW 291 322 1.06e-7 SMART
PTB 393 537 2.87e-41 SMART
PTB 563 693 2.5e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162382
AA Change: M18K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000162994
AA Change: M18K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201776
Predicted Effect probably benign
Transcript: ENSMUST00000161716
Meta Mutation Damage Score 0.9082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Apbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Apbb2 APN 5 66,608,855 (GRCm39) missense probably damaging 1.00
IGL01615:Apbb2 APN 5 66,465,044 (GRCm39) missense probably benign 0.06
IGL01945:Apbb2 APN 5 66,557,594 (GRCm39) missense probably damaging 1.00
IGL03108:Apbb2 APN 5 66,557,574 (GRCm39) missense probably damaging 1.00
IGL03324:Apbb2 APN 5 66,469,500 (GRCm39) critical splice donor site probably null
bund UTSW 5 66,557,598 (GRCm39) missense probably damaging 1.00
Dionysis UTSW 5 66,609,593 (GRCm39) missense probably damaging 0.99
R0266:Apbb2 UTSW 5 66,459,954 (GRCm39) missense probably benign 0.32
R0309:Apbb2 UTSW 5 66,468,331 (GRCm39) splice site probably benign
R0410:Apbb2 UTSW 5 66,609,149 (GRCm39) missense possibly damaging 0.88
R0882:Apbb2 UTSW 5 66,557,598 (GRCm39) missense probably damaging 1.00
R1075:Apbb2 UTSW 5 66,460,021 (GRCm39) missense probably damaging 1.00
R1822:Apbb2 UTSW 5 66,557,520 (GRCm39) missense probably benign 0.00
R1929:Apbb2 UTSW 5 66,464,958 (GRCm39) missense probably benign 0.33
R4157:Apbb2 UTSW 5 66,459,947 (GRCm39) nonsense probably null
R4299:Apbb2 UTSW 5 66,470,721 (GRCm39) missense probably damaging 1.00
R4627:Apbb2 UTSW 5 66,557,419 (GRCm39) splice site probably null
R4780:Apbb2 UTSW 5 66,520,160 (GRCm39) missense probably damaging 1.00
R4940:Apbb2 UTSW 5 66,609,604 (GRCm39) missense probably null
R5002:Apbb2 UTSW 5 66,470,668 (GRCm39) missense possibly damaging 0.87
R5102:Apbb2 UTSW 5 66,469,592 (GRCm39) splice site probably null
R5760:Apbb2 UTSW 5 66,520,100 (GRCm39) missense probably benign
R5868:Apbb2 UTSW 5 66,609,439 (GRCm39) missense probably damaging 1.00
R6272:Apbb2 UTSW 5 66,468,415 (GRCm39) missense probably damaging 0.97
R6280:Apbb2 UTSW 5 66,522,325 (GRCm39) missense probably damaging 1.00
R6399:Apbb2 UTSW 5 66,608,810 (GRCm39) critical splice donor site probably null
R7091:Apbb2 UTSW 5 66,470,677 (GRCm39) missense probably damaging 1.00
R7204:Apbb2 UTSW 5 66,608,946 (GRCm39) missense probably damaging 1.00
R7984:Apbb2 UTSW 5 66,465,035 (GRCm39) missense probably damaging 1.00
R8026:Apbb2 UTSW 5 66,608,987 (GRCm39) missense probably benign 0.00
R8201:Apbb2 UTSW 5 66,466,458 (GRCm39) missense probably benign
R8309:Apbb2 UTSW 5 66,520,179 (GRCm39) missense probably benign 0.01
R8773:Apbb2 UTSW 5 66,609,252 (GRCm39) missense probably damaging 0.99
R8876:Apbb2 UTSW 5 66,609,000 (GRCm39) missense probably benign
R8988:Apbb2 UTSW 5 66,609,444 (GRCm39) missense probably damaging 1.00
R9076:Apbb2 UTSW 5 66,469,507 (GRCm39) missense probably damaging 1.00
R9105:Apbb2 UTSW 5 66,460,015 (GRCm39) nonsense probably null
R9109:Apbb2 UTSW 5 66,609,018 (GRCm39) missense probably benign 0.20
R9298:Apbb2 UTSW 5 66,609,018 (GRCm39) missense probably benign 0.20
R9300:Apbb2 UTSW 5 66,470,677 (GRCm39) missense probably damaging 1.00
R9690:Apbb2 UTSW 5 66,609,521 (GRCm39) missense probably damaging 1.00
X0020:Apbb2 UTSW 5 66,549,142 (GRCm39) missense probably damaging 1.00
Z1088:Apbb2 UTSW 5 66,460,039 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCGGAGGTTAGGTTGATGA -3'
(R):5'- GTGCCTTACAACCCATTTCCTTT -3'

Sequencing Primer
(F):5'- CAGGGCTGAGGTTCTTGTTG -3'
(R):5'- AACCCATTTCCTTTCTGTTC -3'
Posted On 2013-06-11