Incidental Mutation 'R5906:Pkd2'
ID460622
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
MMRRC Submission 044103-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5906 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 104477179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
Predicted Effect probably null
Transcript: ENSMUST00000086831
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130931
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
Gm13441 G C 2: 31,887,499 silent Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Kcnt1 A T 2: 25,894,524 probably benign Het
Kcnt1 T C 2: 25,898,401 F336S probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr145 A G 9: 37,897,878 H158R probably damaging Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sec16a A T 2: 26,438,831 H1057Q possibly damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5195:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104483120 missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104480237 missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104498487 missense probably benign 0.01
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104460049 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACCTACAATGTCTGCCTACCAG -3'
(R):5'- AAACGTTCATCTCTGCGGAAAG -3'

Sequencing Primer
(F):5'- AAGGGTCCCTTCGTGGAG -3'
(R):5'- GAAAGCACTTTCAGCGTTCTC -3'
Posted On2017-02-28