Incidental Mutation 'R0564:Nlrp4b'
ID 46066
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene Name NLR family, pyrin domain containing 4B
Synonyms Nalp4b, Nalp-gamma
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 10421720-10464095 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10448585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 263 (I263V)
Ref Sequence ENSEMBL: ENSMUSP00000113095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
AlphaFold Q8C6J9
Predicted Effect probably benign
Transcript: ENSMUST00000047809
AA Change: I263V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: I263V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117413
AA Change: I263V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: I263V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211772
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10,448,882 (GRCm39) missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10,448,150 (GRCm39) missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10,448,918 (GRCm39) missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10,448,355 (GRCm39) missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10,448,685 (GRCm39) missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10,449,192 (GRCm39) missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10,448,516 (GRCm39) missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10,448,873 (GRCm39) missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10,448,427 (GRCm39) missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10,448,465 (GRCm39) missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10,459,889 (GRCm39) nonsense probably null
R0348:Nlrp4b UTSW 7 10,449,108 (GRCm39) missense possibly damaging 0.60
R0573:Nlrp4b UTSW 7 10,448,142 (GRCm39) missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10,448,457 (GRCm39) missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10,449,363 (GRCm39) missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10,458,979 (GRCm39) missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10,452,520 (GRCm39) missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10,449,266 (GRCm39) missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10,459,863 (GRCm39) missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10,448,655 (GRCm39) missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10,444,170 (GRCm39) nonsense probably null
R2871:Nlrp4b UTSW 7 10,444,170 (GRCm39) nonsense probably null
R2873:Nlrp4b UTSW 7 10,444,170 (GRCm39) nonsense probably null
R2904:Nlrp4b UTSW 7 10,448,294 (GRCm39) missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10,449,456 (GRCm39) missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10,448,808 (GRCm39) missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10,448,358 (GRCm39) missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10,448,660 (GRCm39) missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10,453,130 (GRCm39) missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10,449,225 (GRCm39) missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10,448,145 (GRCm39) missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10,449,172 (GRCm39) nonsense probably null
R5529:Nlrp4b UTSW 7 10,448,873 (GRCm39) missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10,449,512 (GRCm39) missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10,449,414 (GRCm39) missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10,448,418 (GRCm39) missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10,448,640 (GRCm39) nonsense probably null
R6329:Nlrp4b UTSW 7 10,458,847 (GRCm39) missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10,449,339 (GRCm39) missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10,449,144 (GRCm39) missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10,444,297 (GRCm39) missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10,449,143 (GRCm39) missense probably benign 0.12
R7537:Nlrp4b UTSW 7 10,448,816 (GRCm39) missense probably benign 0.05
R7793:Nlrp4b UTSW 7 10,459,001 (GRCm39) missense probably benign 0.00
R8138:Nlrp4b UTSW 7 10,449,458 (GRCm39) missense probably benign 0.01
R8190:Nlrp4b UTSW 7 10,448,319 (GRCm39) missense probably damaging 0.96
R8326:Nlrp4b UTSW 7 10,452,471 (GRCm39) missense probably benign 0.05
R8353:Nlrp4b UTSW 7 10,449,528 (GRCm39) missense probably damaging 0.99
R8417:Nlrp4b UTSW 7 10,459,880 (GRCm39) nonsense probably null
R8453:Nlrp4b UTSW 7 10,449,528 (GRCm39) missense probably damaging 0.99
R8998:Nlrp4b UTSW 7 10,449,629 (GRCm39) missense probably null 0.00
R9002:Nlrp4b UTSW 7 10,448,886 (GRCm39) missense probably damaging 1.00
R9072:Nlrp4b UTSW 7 10,459,870 (GRCm39) missense probably benign 0.02
R9073:Nlrp4b UTSW 7 10,459,870 (GRCm39) missense probably benign 0.02
R9258:Nlrp4b UTSW 7 10,444,087 (GRCm39) missense probably damaging 1.00
R9373:Nlrp4b UTSW 7 10,449,126 (GRCm39) missense probably benign 0.01
R9525:Nlrp4b UTSW 7 10,448,748 (GRCm39) missense probably damaging 0.99
R9604:Nlrp4b UTSW 7 10,444,295 (GRCm39) missense probably benign 0.00
R9670:Nlrp4b UTSW 7 10,448,651 (GRCm39) missense probably benign 0.11
R9679:Nlrp4b UTSW 7 10,449,184 (GRCm39) missense probably benign 0.00
X0063:Nlrp4b UTSW 7 10,463,514 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGATCTGATCTCCAGAGAGTG -3'
(R):5'- ACAGGGGCCTGACATACAGTGAAC -3'

Sequencing Primer
(F):5'- ATCTCCAGAGAGTGGCCTAGC -3'
(R):5'- CATTTTCTCTTATCAAACTGAAGGC -3'
Posted On 2013-06-11