Mutagenetix > Incidental Mutation

Incidental Mutation 'R5906:Espl1'

460662

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

044103-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5906 (G1)

Quality Score

158

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 102296851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably null
Transcript: ENSMUST00000064924

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000229050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

probably null
Transcript: ENSMUST00000230212

Predicted Effect

probably null
Transcript: ENSMUST00000231104

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.4%
20x: 92.4%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	C	A	11: 58,291,434		probably null	Het
9130023H24Rik	G	A	7: 128,236,492	P310S	probably benign	Het
Abcc10	G	T	17: 46,316,559	H652Q	probably benign	Het
Actl6b	A	G	5: 137,567,329	I396V	possibly damaging	Het
Acvr1b	T	C	15: 101,193,891		probably benign	Het
Adamts18	A	T	8: 113,709,619	H989Q	probably benign	Het
Adamtsl4	T	C	3: 95,680,784	Y631C	probably damaging	Het
Angptl3	A	G	4: 99,037,567	T377A	probably benign	Het
Ankmy2	G	A	12: 36,176,633	V109M	probably damaging	Het
Anpep	G	A	7: 79,833,675	A689V	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cacna1d	C	T	14: 30,096,960	V1213I	probably damaging	Het
Capn1	A	G	19: 6,011,421	F156L	possibly damaging	Het
Catsperb	C	A	12: 101,510,462	F408L	probably damaging	Het
Ccdc146	A	T	5: 21,301,352	L697Q	possibly damaging	Het
Cd163l1	T	A	7: 140,228,799	D874E	probably damaging	Het
Cdc37l1	T	A	19: 29,011,986	V281E	probably benign	Het
Chia1	A	T	3: 106,131,988	T465S	probably benign	Het
Cidec	A	T	6: 113,428,321		probably null	Het
Clcnkb	T	C	4: 141,412,299	T131A	probably benign	Het
Clec5a	T	A	6: 40,581,859	M98L	probably benign	Het
Cnga1	A	T	5: 72,610,858	F162I	probably benign	Het
Cyp27b1	A	T	10: 127,048,398	I40F	probably damaging	Het
Edrf1	A	G	7: 133,663,415	S1027G	probably benign	Het
Entpd1	C	A	19: 40,738,839	A448E	probably damaging	Het
Etfdh	T	C	3: 79,604,115	I520V	probably damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gabra4	G	A	5: 71,623,910	P386L	probably benign	Het
Gckr	G	T	5: 31,306,578	V281L	probably damaging	Het
Gfy	T	C	7: 45,177,743	T310A	probably benign	Het
Gjc2	C	A	11: 59,176,841	V272L	probably benign	Het
Gm13441	G	C	2: 31,887,499		silent	Het
H2-DMb2	T	A	17: 34,148,608	M1K	probably null	Het
Hipk3	T	C	2: 104,471,808	Y13C	probably damaging	Het
Kcnt1	A	T	2: 25,894,524		probably benign	Het
Kcnt1	T	C	2: 25,898,401	F336S	probably damaging	Het
Klhdc7b	A	G	15: 89,387,156	D747G	probably benign	Het
Krt78	T	A	15: 101,948,595	E359V	probably damaging	Het
Mast4	T	C	13: 102,735,744	D2195G	probably benign	Het
Matk	C	T	10: 81,260,919	L188F	probably damaging	Het
Mcoln2	T	C	3: 146,183,741	I399T	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Nap1l1	A	T	10: 111,491,030	K151*	probably null	Het
Ncbp3	T	A	11: 73,073,501	S426T	probably benign	Het
Nisch	T	A	14: 31,172,028		probably null	Het
Olfr145	A	G	9: 37,897,878	H158R	probably damaging	Het
Olfr1467	T	C	19: 13,365,005	C126R	probably damaging	Het
Olfr160	A	G	9: 37,711,805	I158T	probably benign	Het
Olfr725	T	C	14: 50,034,849	T185A	probably benign	Het
Peg3	T	C	7: 6,717,855	D17G	probably damaging	Het
Pkd1	G	A	17: 24,572,920	V1194M	probably benign	Het
Pkd1l2	A	T	8: 117,029,648	I1615N	probably damaging	Het
Pkd2	A	T	5: 104,477,179		probably null	Het
Pkp4	T	A	2: 59,305,076	N97K	possibly damaging	Het
Prrx2	C	T	2: 30,879,510	R78C	probably damaging	Het
Pycr1	T	A	11: 120,642,162	I91F	probably damaging	Het
Rap1a	T	C	3: 105,737,765	N87S	possibly damaging	Het
Sbk2	T	G	7: 4,957,628	Y181S	probably damaging	Het
Sec16a	A	T	2: 26,438,831	H1057Q	possibly damaging	Het
Sfswap	G	A	5: 129,542,043	E486K	probably benign	Het
Shank3	T	C	15: 89,548,916	V1213A	probably damaging	Het
Slfn5	T	A	11: 82,957,276	I329K	probably benign	Het
Slit1	T	A	19: 41,606,374	N1186Y	probably damaging	Het
Ssbp3	A	G	4: 107,009,821		probably benign	Het
Steap3	T	A	1: 120,244,001	I125F	probably damaging	Het
Synpr	C	A	14: 13,608,788		probably benign	Het
Tom1	T	C	8: 75,050,258	L69P	probably damaging	Het
Traf3ip3	T	A	1: 193,198,006	D5V	possibly damaging	Het
Vmn1r29	G	A	6: 58,307,751	S152N	probably benign	Het
Vmn1r68	T	C	7: 10,527,623	I183V	probably benign	Het
Wdr17	C	G	8: 54,639,468	V1094L	probably benign	Het
Wdr95	A	G	5: 149,564,227	I109V	possibly damaging	Het
Zfp39	T	C	11: 58,902,891	D7G	probably benign	Het
Zfp512	A	T	5: 31,480,064	Q443L	probably damaging	Het
Zfp974	T	A	7: 27,910,805	K498N	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCGCATAGGATTTCTGG -3'
(R):5'- ATGATCACATTAGTAGCCCTAGGG -3'

Sequencing Primer
(F):5'- CGCATAGGATTTCTGGTGGGATTC -3'
(R):5'- GGCTGGCTTCGAACTCAGAAATTC -3'

Posted On

2017-02-28