Incidental Mutation 'R5906:Espl1'
ID 460662
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 044103-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5906 (G1)
Quality Score 158
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 102205286 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
AlphaFold P60330
Predicted Effect probably null
Transcript: ENSMUST00000064924
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably null
Transcript: ENSMUST00000230212
Predicted Effect probably null
Transcript: ENSMUST00000231104
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,182,260 (GRCm39) probably null Het
9130023H24Rik G A 7: 127,835,664 (GRCm39) P310S probably benign Het
Abcc10 G T 17: 46,627,485 (GRCm39) H652Q probably benign Het
Actl6b A G 5: 137,565,591 (GRCm39) I396V possibly damaging Het
Acvr1b T C 15: 101,091,772 (GRCm39) probably benign Het
Adamts18 A T 8: 114,436,251 (GRCm39) H989Q probably benign Het
Adamtsl4 T C 3: 95,588,094 (GRCm39) Y631C probably damaging Het
Angptl3 A G 4: 98,925,804 (GRCm39) T377A probably benign Het
Ankmy2 G A 12: 36,226,632 (GRCm39) V109M probably damaging Het
Anpep G A 7: 79,483,423 (GRCm39) A689V probably benign Het
Brwd1 A T 16: 95,859,938 (GRCm39) M350K probably damaging Het
Cacna1d C T 14: 29,818,917 (GRCm39) V1213I probably damaging Het
Capn1 A G 19: 6,061,451 (GRCm39) F156L possibly damaging Het
Catsperb C A 12: 101,476,721 (GRCm39) F408L probably damaging Het
Ccdc146 A T 5: 21,506,350 (GRCm39) L697Q possibly damaging Het
Cdc37l1 T A 19: 28,989,386 (GRCm39) V281E probably benign Het
Chia1 A T 3: 106,039,304 (GRCm39) T465S probably benign Het
Cidec A T 6: 113,405,282 (GRCm39) probably null Het
Clcnkb T C 4: 141,139,610 (GRCm39) T131A probably benign Het
Clec5a T A 6: 40,558,793 (GRCm39) M98L probably benign Het
Cnga1 A T 5: 72,768,201 (GRCm39) F162I probably benign Het
Cyp27b1 A T 10: 126,884,267 (GRCm39) I40F probably damaging Het
Edrf1 A G 7: 133,265,144 (GRCm39) S1027G probably benign Het
Entpd1 C A 19: 40,727,283 (GRCm39) A448E probably damaging Het
Etfdh T C 3: 79,511,422 (GRCm39) I520V probably damaging Het
Fchsd1 C T 18: 38,092,926 (GRCm39) probably benign Het
Gabra4 G A 5: 71,781,253 (GRCm39) P386L probably benign Het
Gckr G T 5: 31,463,922 (GRCm39) V281L probably damaging Het
Gfy T C 7: 44,827,167 (GRCm39) T310A probably benign Het
Gjc2 C A 11: 59,067,667 (GRCm39) V272L probably benign Het
Gm13441 G C 2: 31,777,511 (GRCm39) silent Het
H2-DMb2 T A 17: 34,367,582 (GRCm39) M1K probably null Het
Hipk3 T C 2: 104,302,153 (GRCm39) Y13C probably damaging Het
Kcnt1 A T 2: 25,784,536 (GRCm39) probably benign Het
Kcnt1 T C 2: 25,788,413 (GRCm39) F336S probably damaging Het
Klhdc7b A G 15: 89,271,359 (GRCm39) D747G probably benign Het
Krt78 T A 15: 101,857,030 (GRCm39) E359V probably damaging Het
Mast4 T C 13: 102,872,252 (GRCm39) D2195G probably benign Het
Matk C T 10: 81,096,753 (GRCm39) L188F probably damaging Het
Mcoln2 T C 3: 145,889,496 (GRCm39) I399T probably damaging Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Nap1l1 A T 10: 111,326,891 (GRCm39) K151* probably null Het
Ncbp3 T A 11: 72,964,327 (GRCm39) S426T probably benign Het
Nisch T A 14: 30,893,985 (GRCm39) probably null Het
Or4k15b T C 14: 50,272,306 (GRCm39) T185A probably benign Het
Or5b113 T C 19: 13,342,369 (GRCm39) C126R probably damaging Het
Or8a1b A G 9: 37,623,101 (GRCm39) I158T probably benign Het
Or8b8 A G 9: 37,809,174 (GRCm39) H158R probably damaging Het
Peg3 T C 7: 6,720,854 (GRCm39) D17G probably damaging Het
Pkd1 G A 17: 24,791,894 (GRCm39) V1194M probably benign Het
Pkd1l2 A T 8: 117,756,387 (GRCm39) I1615N probably damaging Het
Pkd2 A T 5: 104,625,045 (GRCm39) probably null Het
Pkp4 T A 2: 59,135,420 (GRCm39) N97K possibly damaging Het
Prrx2 C T 2: 30,769,522 (GRCm39) R78C probably damaging Het
Pycr1 T A 11: 120,532,988 (GRCm39) I91F probably damaging Het
Rap1a T C 3: 105,645,081 (GRCm39) N87S possibly damaging Het
Sbk2 T G 7: 4,960,627 (GRCm39) Y181S probably damaging Het
Scart1 T A 7: 139,808,712 (GRCm39) D874E probably damaging Het
Sec16a A T 2: 26,328,843 (GRCm39) H1057Q possibly damaging Het
Sfswap G A 5: 129,619,107 (GRCm39) E486K probably benign Het
Shank3 T C 15: 89,433,119 (GRCm39) V1213A probably damaging Het
Slfn5 T A 11: 82,848,102 (GRCm39) I329K probably benign Het
Slit1 T A 19: 41,594,813 (GRCm39) N1186Y probably damaging Het
Ssbp3 A G 4: 106,867,018 (GRCm39) probably benign Het
Steap3 T A 1: 120,171,731 (GRCm39) I125F probably damaging Het
Synpr C A 14: 13,608,788 (GRCm38) probably benign Het
Tom1 T C 8: 75,776,886 (GRCm39) L69P probably damaging Het
Traf3ip3 T A 1: 192,880,314 (GRCm39) D5V possibly damaging Het
Vmn1r29 G A 6: 58,284,736 (GRCm39) S152N probably benign Het
Vmn1r68 T C 7: 10,261,550 (GRCm39) I183V probably benign Het
Wdr17 C G 8: 55,092,503 (GRCm39) V1094L probably benign Het
Wdr95 A G 5: 149,487,692 (GRCm39) I109V possibly damaging Het
Zfp39 T C 11: 58,793,717 (GRCm39) D7G probably benign Het
Zfp512 A T 5: 31,637,408 (GRCm39) Q443L probably damaging Het
Zfp974 T A 7: 27,610,230 (GRCm39) K498N possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCGCATAGGATTTCTGG -3'
(R):5'- ATGATCACATTAGTAGCCCTAGGG -3'

Sequencing Primer
(F):5'- CGCATAGGATTTCTGGTGGGATTC -3'
(R):5'- GGCTGGCTTCGAACTCAGAAATTC -3'
Posted On 2017-02-28