Incidental Mutation 'R0564:Or52p2'
ID 46068
Institutional Source Beutler Lab
Gene Symbol Or52p2
Ensembl Gene ENSMUSG00000073974
Gene Name olfactory receptor family 52 subfamily P member 2
Synonyms Olfr551, MOR29-1, GA_x6K02T2PBJ9-5307445-5306498
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 102236948-102238026 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102237738 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000150582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098224] [ENSMUST00000213540]
AlphaFold Q8VG23
Predicted Effect probably benign
Transcript: ENSMUST00000098224
AA Change: I71V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095827
Gene: ENSMUSG00000073974
AA Change: I71V

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.8e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 152 2e-9 PFAM
Pfam:7tm_1 43 293 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
AA Change: I71V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Or52p2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Or52p2 APN 7 102,237,436 (GRCm39) nonsense probably null
IGL03034:Or52p2 APN 7 102,237,147 (GRCm39) missense probably benign 0.42
IGL03076:Or52p2 APN 7 102,237,679 (GRCm39) missense probably benign
R0890:Or52p2 UTSW 7 102,237,408 (GRCm39) nonsense probably null
R0909:Or52p2 UTSW 7 102,237,654 (GRCm39) missense probably damaging 1.00
R1053:Or52p2 UTSW 7 102,237,166 (GRCm39) nonsense probably null
R4708:Or52p2 UTSW 7 102,237,043 (GRCm39) missense probably benign 0.00
R4932:Or52p2 UTSW 7 102,237,623 (GRCm39) missense probably damaging 0.98
R6248:Or52p2 UTSW 7 102,237,237 (GRCm39) missense probably benign 0.00
R6343:Or52p2 UTSW 7 102,237,753 (GRCm39) missense probably damaging 0.98
R6389:Or52p2 UTSW 7 102,237,679 (GRCm39) missense probably benign
R6455:Or52p2 UTSW 7 102,237,878 (GRCm39) missense probably benign 0.00
R7305:Or52p2 UTSW 7 102,237,162 (GRCm39) missense possibly damaging 0.94
R7638:Or52p2 UTSW 7 102,237,125 (GRCm39) missense probably damaging 0.98
R7743:Or52p2 UTSW 7 102,237,638 (GRCm39) missense probably benign 0.32
R7792:Or52p2 UTSW 7 102,238,090 (GRCm39) start gained probably benign
R8855:Or52p2 UTSW 7 102,237,945 (GRCm39) missense probably benign
Z1177:Or52p2 UTSW 7 102,237,929 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CACAGACTCTGAGGACAGCAATGAC -3'
(R):5'- TCGGCCTGATCATGCAACACAC -3'

Sequencing Primer
(F):5'- CAATGACCCGTAGTGCAATG -3'
(R):5'- GAACCCAAGCTCCTTCCTG -3'
Posted On 2013-06-11