Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Itga4'

460681

Institutional Source

Beutler Lab

Gene Symbol

Itga4

Ensembl Gene

ENSMUSG00000027009

Gene Name

integrin alpha 4

Synonyms

VLA-4 receptor, alpha 4 subunit

MMRRC Submission

044104-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79255426-79333123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79322656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 896 (H896Y)

Ref Sequence

ENSEMBL: ENSMUSP00000099718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099972]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099972
AA Change: H896Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009
AA Change: H896Y

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Int_alpha	48	108	5.14e-7	SMART
Int_alpha	191	241	3.45e1	SMART
Int_alpha	247	300	1.89e-5	SMART
Int_alpha	302	358	2.25e-12	SMART
Int_alpha	364	419	1.45e-15	SMART
Int_alpha	426	483	4.52e-3	SMART
SCOP:d1m1xa2	627	770	1e-35	SMART
Blast:Int_alpha	639	676	9e-16	BLAST
SCOP:d1m1xa3	773	948	7e-42	SMART
transmembrane domain	978	1000	N/A	INTRINSIC
PDB:4HKC\|B	1003	1032	1e-13	PDB

Meta Mutation Damage Score

0.0746

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adamts16	C	A	13: 70,728,910	C1204F	probably damaging	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dopey2	A	T	16: 93,801,581	H1878L	probably damaging	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Ift140	A	G	17: 25,092,371	D1180G	probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga7	T	C	10: 128,942,981	Y326H	probably damaging	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Rpe65	T	C	3: 159,615,682		probably null	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Itga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Itga4	APN	2	79292050	missense	probably benign	0.01
IGL01317:Itga4	APN	2	79322661	nonsense	probably null
IGL01545:Itga4	APN	2	79315970	splice site	probably benign
IGL01570:Itga4	APN	2	79322634	critical splice acceptor site	probably null
IGL01575:Itga4	APN	2	79288255	missense	probably damaging	1.00
IGL01837:Itga4	APN	2	79315005	missense	probably damaging	1.00
IGL01974:Itga4	APN	2	79273127	splice site	probably benign
IGL02087:Itga4	APN	2	79292069	missense	probably damaging	0.99
IGL02245:Itga4	APN	2	79320559	missense	probably benign	0.01
IGL02492:Itga4	APN	2	79255657	utr 5 prime	probably benign
IGL02809:Itga4	APN	2	79280577	missense	probably damaging	1.00
IGL02998:Itga4	APN	2	79277821	missense	possibly damaging	0.88
IGL03008:Itga4	APN	2	79325638	missense	probably benign
IGL03282:Itga4	APN	2	79325594	missense	probably damaging	0.98
IGL03285:Itga4	APN	2	79279166	missense	possibly damaging	0.48
IGL03286:Itga4	APN	2	79289362	missense	probably damaging	1.00
R0001:Itga4	UTSW	2	79326587	missense	probably damaging	0.99
R0045:Itga4	UTSW	2	79301031	missense	probably damaging	1.00
R0276:Itga4	UTSW	2	79321493	missense	probably damaging	0.99
R0554:Itga4	UTSW	2	79279117	missense	probably damaging	1.00
R0556:Itga4	UTSW	2	79325639	missense	probably benign
R0785:Itga4	UTSW	2	79289305	missense	possibly damaging	0.89
R0787:Itga4	UTSW	2	79279153	missense	probably benign	0.01
R1013:Itga4	UTSW	2	79320503	missense	probably benign	0.00
R1237:Itga4	UTSW	2	79279146	missense	probably null	0.08
R1295:Itga4	UTSW	2	79322689	missense	possibly damaging	0.82
R1471:Itga4	UTSW	2	79287032	missense	probably benign	0.26
R1559:Itga4	UTSW	2	79315688	missense	probably benign	0.04
R1769:Itga4	UTSW	2	79315706	critical splice donor site	probably null
R1931:Itga4	UTSW	2	79313844	critical splice donor site	probably null
R2012:Itga4	UTSW	2	79277794	missense	probably damaging	1.00
R2241:Itga4	UTSW	2	79301013	missense	probably damaging	1.00
R3793:Itga4	UTSW	2	79279128	missense	probably benign	0.01
R4133:Itga4	UTSW	2	79322652	missense	probably damaging	1.00
R4204:Itga4	UTSW	2	79279161	missense	probably damaging	0.97
R4296:Itga4	UTSW	2	79272799	missense	probably damaging	1.00
R4777:Itga4	UTSW	2	79313710	missense	possibly damaging	0.87
R4906:Itga4	UTSW	2	79288248	missense	probably damaging	1.00
R5048:Itga4	UTSW	2	79273034	missense	probably benign	0.04
R5087:Itga4	UTSW	2	79315629	missense	possibly damaging	0.95
R5212:Itga4	UTSW	2	79280595	missense	probably damaging	1.00
R5213:Itga4	UTSW	2	79320576	missense	probably benign	0.29
R5421:Itga4	UTSW	2	79316041	nonsense	probably null
R5549:Itga4	UTSW	2	79256267	missense	probably damaging	0.98
R5917:Itga4	UTSW	2	79287098	missense	probably damaging	1.00
R6309:Itga4	UTSW	2	79279085	missense	probably damaging	1.00
R6764:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R6787:Itga4	UTSW	2	79289265	missense	probably damaging	0.97
R6790:Itga4	UTSW	2	79325614	missense	probably benign	0.02
R7051:Itga4	UTSW	2	79318126	missense	possibly damaging	0.91
R7311:Itga4	UTSW	2	79256182	missense	probably benign
R7520:Itga4	UTSW	2	79300989	missense	probably damaging	1.00
R7573:Itga4	UTSW	2	79272993	missense	probably benign
R7636:Itga4	UTSW	2	79313832	missense	probably benign	0.01
R7889:Itga4	UTSW	2	79316045	missense	probably benign	0.05
R8123:Itga4	UTSW	2	79315683	missense	probably benign
R8284:Itga4	UTSW	2	79321439	missense	probably benign	0.00
R8445:Itga4	UTSW	2	79281781	missense	probably benign
R8553:Itga4	UTSW	2	79301061	missense	probably damaging	0.97
R8696:Itga4	UTSW	2	79281781	missense	probably benign
R8900:Itga4	UTSW	2	79314988	missense	probably damaging	1.00
R8922:Itga4	UTSW	2	79255594	utr 5 prime	probably benign
R9359:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48
R9403:Itga4	UTSW	2	79325660	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- CATCTTGTGGTAGGAACAGTGG -3'
(R):5'- TGCTATAGTTCATCTCTGTCAGG -3'

Sequencing Primer
(F):5'- TGTGGTAGGAACAGTGGGATTATAAG -3'
(R):5'- ATATGAACGCTGGCTTCC -3'

Posted On

2017-02-28