Incidental Mutation 'R5907:Olfr1058'
ID460682
Institutional Source Beutler Lab
Gene Symbol Olfr1058
Ensembl Gene ENSMUSG00000075186
Gene Nameolfactory receptor 1058
SynonymsGA_x6K02T2Q125-47855818-47854868, MOR190-2
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86384760-86388561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86385874 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 181 (S181R)
Ref Sequence ENSEMBL: ENSMUSP00000151037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102631] [ENSMUST00000213998]
Predicted Effect probably damaging
Transcript: ENSMUST00000102631
AA Change: S181R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099691
Gene: ENSMUSG00000075186
AA Change: S181R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7tm_1 41 290 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213998
AA Change: S181R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215214
Meta Mutation Damage Score 0.2524 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Olfr1058
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr1058 APN 2 86386021 nonsense probably null
R0413:Olfr1058 UTSW 2 86385714 missense probably benign 0.02
R1315:Olfr1058 UTSW 2 86386174 missense possibly damaging 0.86
R1609:Olfr1058 UTSW 2 86385494 missense probably benign 0.07
R1951:Olfr1058 UTSW 2 86385511 missense probably benign 0.03
R2184:Olfr1058 UTSW 2 86386145 missense probably benign 0.05
R2351:Olfr1058 UTSW 2 86386127 missense probably damaging 0.99
R4067:Olfr1058 UTSW 2 86386087 nonsense probably null
R4706:Olfr1058 UTSW 2 86386388 missense probably benign 0.29
R5164:Olfr1058 UTSW 2 86385471 missense probably benign
R5224:Olfr1058 UTSW 2 86385849 missense possibly damaging 0.91
R5254:Olfr1058 UTSW 2 86386140 missense possibly damaging 0.65
R5424:Olfr1058 UTSW 2 86385840 nonsense probably null
R5980:Olfr1058 UTSW 2 86385797 nonsense probably null
R6348:Olfr1058 UTSW 2 86386169 missense probably benign
R6874:Olfr1058 UTSW 2 86385528 missense possibly damaging 0.95
R6897:Olfr1058 UTSW 2 86385680 missense possibly damaging 0.91
R7060:Olfr1058 UTSW 2 86386225 missense possibly damaging 0.95
R7516:Olfr1058 UTSW 2 86385984 missense probably benign 0.35
R7530:Olfr1058 UTSW 2 86386171 missense probably damaging 1.00
Z1088:Olfr1058 UTSW 2 86385756 missense probably benign 0.43
Z1088:Olfr1058 UTSW 2 86386179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCATAGAAGACAGTGACC -3'
(R):5'- GACCGCTATGTGGCTATCTG -3'

Sequencing Primer
(F):5'- TGACCATTGTCAGGTGGGACC -3'
(R):5'- ACCGCTATGTGGCTATCTGTAAGC -3'
Posted On2017-02-28