Incidental Mutation 'R5907:Vmn2r4'
ID 460686
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Name vomeronasal 2, receptor 4
Synonyms EG637053
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 64295982-64322741 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 64298487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 547 (P547Q)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
AlphaFold K7N784
Predicted Effect probably damaging
Transcript: ENSMUST00000170280
AA Change: P458Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: P458Q

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: P547Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: P547Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64,317,200 (GRCm39) splice site probably null
IGL01448:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64,313,816 (GRCm39) missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64,313,844 (GRCm39) missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64,313,657 (GRCm39) missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64,298,431 (GRCm39) missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64,305,782 (GRCm39) splice site probably benign
IGL02276:Vmn2r4 APN 3 64,313,877 (GRCm39) missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64,313,821 (GRCm39) missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64,305,840 (GRCm39) nonsense probably null
IGL02655:Vmn2r4 APN 3 64,305,886 (GRCm39) missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64,296,433 (GRCm39) missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64,314,337 (GRCm39) missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64,296,589 (GRCm39) missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64,314,063 (GRCm39) missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64,305,850 (GRCm39) missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64,296,855 (GRCm39) nonsense probably null
R0504:Vmn2r4 UTSW 3 64,296,784 (GRCm39) missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64,314,309 (GRCm39) missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64,296,865 (GRCm39) missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64,314,410 (GRCm39) missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64,298,479 (GRCm39) missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64,305,976 (GRCm39) missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64,322,704 (GRCm39) missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64,296,788 (GRCm39) missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64,296,896 (GRCm39) missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64,296,895 (GRCm39) missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64,322,572 (GRCm39) missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64,322,590 (GRCm39) missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64,317,201 (GRCm39) critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64,317,384 (GRCm39) missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64,298,397 (GRCm39) missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64,296,082 (GRCm39) missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64,317,484 (GRCm39) missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64,313,676 (GRCm39) missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64,296,476 (GRCm39) missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64,306,019 (GRCm39) splice site probably null
R5092:Vmn2r4 UTSW 3 64,298,373 (GRCm39) missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64,305,878 (GRCm39) missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64,314,358 (GRCm39) missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64,317,370 (GRCm39) missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64,322,687 (GRCm39) nonsense probably null
R5924:Vmn2r4 UTSW 3 64,296,685 (GRCm39) missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64,314,364 (GRCm39) missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64,322,702 (GRCm39) missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64,322,699 (GRCm39) missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64,313,926 (GRCm39) missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64,317,378 (GRCm39) missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64,322,519 (GRCm39) missense probably benign
R6545:Vmn2r4 UTSW 3 64,313,777 (GRCm39) missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64,296,731 (GRCm39) missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64,296,550 (GRCm39) missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64,305,898 (GRCm39) missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64,322,681 (GRCm39) missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64,314,432 (GRCm39) missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64,305,850 (GRCm39) missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64,322,657 (GRCm39) missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64,317,226 (GRCm39) missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64,313,943 (GRCm39) missense probably damaging 0.99
R8678:Vmn2r4 UTSW 3 64,314,391 (GRCm39) missense probably benign
R8743:Vmn2r4 UTSW 3 64,317,247 (GRCm39) missense possibly damaging 0.95
R8841:Vmn2r4 UTSW 3 64,314,058 (GRCm39) missense probably damaging 0.97
R9671:Vmn2r4 UTSW 3 64,317,271 (GRCm39) missense probably benign 0.00
R9778:Vmn2r4 UTSW 3 64,322,497 (GRCm39) missense probably benign 0.15
X0019:Vmn2r4 UTSW 3 64,314,057 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGATTCCAAGGTTGTCTTTGTC -3'
(R):5'- CAGAGTCAATCACAAGACTGTCTTTAG -3'

Sequencing Primer
(F):5'- ACCTGGTTTCTCTGACAC -3'
(R):5'- AGATGAAGTTCTTTCCAGGATCTCC -3'
Posted On 2017-02-28