Incidental Mutation 'R5907:Vmn2r4'
ID460686
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64391066 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 547 (P547Q)
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably damaging
Transcript: ENSMUST00000170280
AA Change: P458Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: P458Q

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175724
AA Change: P547Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: P547Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4710:Vmn2r4 UTSW 3 64409780 critical splice donor site probably null
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGATTCCAAGGTTGTCTTTGTC -3'
(R):5'- CAGAGTCAATCACAAGACTGTCTTTAG -3'

Sequencing Primer
(F):5'- ACCTGGTTTCTCTGACAC -3'
(R):5'- AGATGAAGTTCTTTCCAGGATCTCC -3'
Posted On2017-02-28