Incidental Mutation 'R5907:Etv3'
ID 460687
Institutional Source Beutler Lab
Gene Symbol Etv3
Ensembl Gene ENSMUSG00000003382
Gene Name ets variant 3
Synonyms METS, ETS-domain transcriptional repressor, Pe1
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 87432891-87447463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87442850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000127419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117293] [ENSMUST00000119109] [ENSMUST00000170036]
AlphaFold Q8R4Z4
Predicted Effect probably benign
Transcript: ENSMUST00000117293
SMART Domains Protein: ENSMUSP00000114047
Gene: ENSMUSG00000003382

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119109
AA Change: T145A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112915
Gene: ENSMUSG00000003382
AA Change: T145A

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152010
Predicted Effect probably benign
Transcript: ENSMUST00000170036
AA Change: T145A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127419
Gene: ENSMUSG00000003382
AA Change: T145A

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Etv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Etv3 APN 3 87,443,025 (GRCm39) missense possibly damaging 0.68
IGL02613:Etv3 APN 3 87,443,702 (GRCm39) missense possibly damaging 0.53
IGL02698:Etv3 APN 3 87,443,885 (GRCm39) missense possibly damaging 0.53
Rodeo UTSW 3 87,443,338 (GRCm39) nonsense probably null
Schooled UTSW 3 87,436,577 (GRCm39) missense probably damaging 1.00
R0056:Etv3 UTSW 3 87,443,135 (GRCm39) missense possibly damaging 0.86
R2074:Etv3 UTSW 3 87,443,526 (GRCm39) missense probably benign
R2104:Etv3 UTSW 3 87,443,369 (GRCm39) missense possibly damaging 0.53
R4120:Etv3 UTSW 3 87,443,589 (GRCm39) missense probably benign 0.00
R4923:Etv3 UTSW 3 87,443,223 (GRCm39) missense possibly damaging 0.96
R4960:Etv3 UTSW 3 87,435,368 (GRCm39) missense probably damaging 1.00
R5642:Etv3 UTSW 3 87,443,322 (GRCm39) missense possibly damaging 0.96
R6020:Etv3 UTSW 3 87,436,671 (GRCm39) missense probably benign
R6882:Etv3 UTSW 3 87,436,577 (GRCm39) missense probably damaging 1.00
R7515:Etv3 UTSW 3 87,435,363 (GRCm39) missense possibly damaging 0.58
R7570:Etv3 UTSW 3 87,443,338 (GRCm39) nonsense probably null
R8340:Etv3 UTSW 3 87,443,856 (GRCm39) missense possibly damaging 0.85
R8690:Etv3 UTSW 3 87,443,786 (GRCm39) missense possibly damaging 0.93
R9664:Etv3 UTSW 3 87,443,172 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GATGGATGACATGGCCTGTG -3'
(R):5'- TTTCGGGAGGGCATGAAGTC -3'

Sequencing Primer
(F):5'- ACCCAGCCTGAGCAATAGTTTTG -3'
(R):5'- ATGAAGTCCATGCCCCGGTG -3'
Posted On 2017-02-28