Incidental Mutation 'R0564:Cdc16'
ID 46069
Institutional Source Beutler Lab
Gene Symbol Cdc16
Ensembl Gene ENSMUSG00000038416
Gene Name CDC16 cell division cycle 16
Synonyms 2700071J12Rik, 2810431D22Rik
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 13807676-13831938 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13831618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 617 (D617V)
Ref Sequence ENSEMBL: ENSMUSP00000047950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043767] [ENSMUST00000043962]
AlphaFold Q8R349
Predicted Effect probably benign
Transcript: ENSMUST00000043767
SMART Domains Protein: ENSMUSP00000037354
Gene: ENSMUSG00000038398

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:Smg4_UPF3 63 224 1.4e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043962
AA Change: D617V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047950
Gene: ENSMUSG00000038416
AA Change: D617V

DomainStartEndE-ValueType
Pfam:TPR_9 11 63 1.8e-3 PFAM
Pfam:ANAPC3 15 95 3.5e-23 PFAM
TPR 130 163 1.17e1 SMART
Blast:TPR 299 333 2e-8 BLAST
Blast:TPR 334 367 1e-14 BLAST
TPR 368 401 1.48e1 SMART
Blast:TPR 402 435 7e-15 BLAST
TPR 445 478 6.68e-6 SMART
TPR 479 512 1.74e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211724
Meta Mutation Damage Score 0.1463 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Cdc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cdc16 APN 8 13,817,575 (GRCm39) nonsense probably null
IGL01109:Cdc16 APN 8 13,814,606 (GRCm39) missense probably benign 0.00
IGL01475:Cdc16 APN 8 13,831,542 (GRCm39) missense probably benign
IGL02729:Cdc16 APN 8 13,829,250 (GRCm39) missense possibly damaging 0.93
IGL03389:Cdc16 APN 8 13,809,179 (GRCm39) missense probably damaging 1.00
R0026:Cdc16 UTSW 8 13,809,130 (GRCm39) splice site probably null
R0373:Cdc16 UTSW 8 13,829,264 (GRCm39) missense probably benign 0.04
R0520:Cdc16 UTSW 8 13,810,569 (GRCm39) critical splice donor site probably null
R1470:Cdc16 UTSW 8 13,808,992 (GRCm39) splice site probably benign
R1487:Cdc16 UTSW 8 13,821,445 (GRCm39) missense probably benign 0.17
R1753:Cdc16 UTSW 8 13,814,688 (GRCm39) nonsense probably null
R1883:Cdc16 UTSW 8 13,825,738 (GRCm39) missense probably damaging 1.00
R3087:Cdc16 UTSW 8 13,809,004 (GRCm39) missense probably damaging 0.98
R3418:Cdc16 UTSW 8 13,819,489 (GRCm39) nonsense probably null
R3756:Cdc16 UTSW 8 13,827,609 (GRCm39) critical splice donor site probably null
R4152:Cdc16 UTSW 8 13,812,857 (GRCm39) missense probably damaging 1.00
R4842:Cdc16 UTSW 8 13,831,644 (GRCm39) utr 3 prime probably benign
R5122:Cdc16 UTSW 8 13,814,570 (GRCm39) missense probably damaging 1.00
R5492:Cdc16 UTSW 8 13,813,915 (GRCm39) splice site probably null
R5982:Cdc16 UTSW 8 13,831,399 (GRCm39) missense possibly damaging 0.73
R6145:Cdc16 UTSW 8 13,817,573 (GRCm39) missense possibly damaging 0.96
R6154:Cdc16 UTSW 8 13,818,609 (GRCm39) missense possibly damaging 0.87
R6611:Cdc16 UTSW 8 13,831,512 (GRCm39) missense probably benign
R6992:Cdc16 UTSW 8 13,809,188 (GRCm39) missense probably benign 0.22
R7011:Cdc16 UTSW 8 13,819,451 (GRCm39) missense probably damaging 1.00
R7484:Cdc16 UTSW 8 13,827,605 (GRCm39) missense probably benign 0.01
R7593:Cdc16 UTSW 8 13,827,605 (GRCm39) missense probably benign 0.01
R7946:Cdc16 UTSW 8 13,812,882 (GRCm39) missense probably benign 0.22
R9019:Cdc16 UTSW 8 13,831,501 (GRCm39) missense probably benign
R9655:Cdc16 UTSW 8 13,809,153 (GRCm39) missense possibly damaging 0.93
R9668:Cdc16 UTSW 8 13,817,552 (GRCm39) missense possibly damaging 0.94
R9796:Cdc16 UTSW 8 13,807,693 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCCCCTGTGACCAGTGTTTATG -3'
(R):5'- AAAATCGGAAAACATCTGTTGCCAAGG -3'

Sequencing Primer
(F):5'- AAAGTGCTATGACTTCGATGTGC -3'
(R):5'- TGCTGTCCCACTGTTACTG -3'
Posted On 2013-06-11