Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Rpe65'

460693

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

044104-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R5907 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 159615682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably null
Transcript: ENSMUST00000029824

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000196999

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adamts16	C	A	13: 70,728,910	C1204F	probably damaging	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dopey2	A	T	16: 93,801,581	H1878L	probably damaging	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Ift140	A	G	17: 25,092,371	D1180G	probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga4	C	T	2: 79,322,656	H896Y	probably benign	Het
Itga7	T	C	10: 128,942,981	Y326H	probably damaging	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGTGACCTAAGGAACAATCAC -3'
(R):5'- GATGGGAATCACTGGGTCTG -3'

Sequencing Primer
(F):5'- AGTTCAAGGTCAGCCTATGC -3'
(R):5'- ACATATCATCTTGGCTCTGTGGAAG -3'

Posted On

2017-02-28