Incidental Mutation 'R5907:Vmn2r26'
ID460703
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124039871 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 431 (N431K)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: N431K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: N431K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R7914:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTCTGGGATCTAAGTCAATGTGAG -3'
(R):5'- AGTCATGGATGATATTGTTGAGCC -3'

Sequencing Primer
(F):5'- TCTAAGTCAATGTGAGCCAAATGG -3'
(R):5'- CTGCCTCCTAAATGCTGGGATTAAG -3'
Posted On2017-02-28