Incidental Mutation 'R5907:Abcc8'
ID 460707
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene Name ATP-binding cassette, sub-family C member 8
Synonyms SUR1, Sur, D930031B21Rik
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.500) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45753952-45829441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45773330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 800 (F800L)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
AlphaFold B2RUS7
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: F800L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: F800L

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210110
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: F121L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211767
Meta Mutation Damage Score 0.1731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 45,754,088 (GRCm39) missense probably benign
IGL01457:Abcc8 APN 7 45,784,917 (GRCm39) missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 45,764,477 (GRCm39) missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 45,801,091 (GRCm39) missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 45,774,273 (GRCm39) missense probably benign 0.01
IGL01912:Abcc8 APN 7 45,769,934 (GRCm39) missense probably damaging 1.00
IGL02218:Abcc8 APN 7 45,769,860 (GRCm39) missense probably benign 0.00
IGL02326:Abcc8 APN 7 45,772,281 (GRCm39) critical splice donor site probably null
IGL02403:Abcc8 APN 7 45,755,227 (GRCm39) splice site probably null
IGL02411:Abcc8 APN 7 45,756,431 (GRCm39) missense probably damaging 1.00
IGL02653:Abcc8 APN 7 45,765,191 (GRCm39) splice site probably benign
IGL02706:Abcc8 APN 7 45,816,345 (GRCm39) missense probably benign 0.08
R0295:Abcc8 UTSW 7 45,767,478 (GRCm39) missense probably benign
R0381:Abcc8 UTSW 7 45,757,858 (GRCm39) missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 45,771,597 (GRCm39) missense probably damaging 0.98
R0408:Abcc8 UTSW 7 45,756,457 (GRCm39) missense probably damaging 0.99
R0496:Abcc8 UTSW 7 45,758,244 (GRCm39) missense probably damaging 1.00
R1126:Abcc8 UTSW 7 45,759,062 (GRCm39) missense probably damaging 0.99
R1323:Abcc8 UTSW 7 45,766,786 (GRCm39) missense probably benign 0.07
R1323:Abcc8 UTSW 7 45,766,786 (GRCm39) missense probably benign 0.07
R1352:Abcc8 UTSW 7 45,784,892 (GRCm39) splice site probably benign
R1368:Abcc8 UTSW 7 45,772,284 (GRCm39) missense probably damaging 1.00
R1437:Abcc8 UTSW 7 45,829,237 (GRCm39) missense probably damaging 1.00
R1463:Abcc8 UTSW 7 45,803,936 (GRCm39) missense probably benign 0.12
R1689:Abcc8 UTSW 7 45,769,827 (GRCm39) missense probably benign 0.16
R1717:Abcc8 UTSW 7 45,765,239 (GRCm39) missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 45,769,903 (GRCm39) missense probably benign 0.02
R1848:Abcc8 UTSW 7 45,816,326 (GRCm39) missense probably benign
R1870:Abcc8 UTSW 7 45,773,339 (GRCm39) missense probably benign 0.05
R1938:Abcc8 UTSW 7 45,824,795 (GRCm39) missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 45,766,847 (GRCm39) splice site probably null
R1994:Abcc8 UTSW 7 45,806,543 (GRCm39) missense probably benign 0.02
R2511:Abcc8 UTSW 7 45,800,204 (GRCm39) missense probably damaging 1.00
R3840:Abcc8 UTSW 7 45,757,524 (GRCm39) missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 45,754,051 (GRCm39) missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 45,785,618 (GRCm39) missense probably benign 0.09
R4463:Abcc8 UTSW 7 45,756,005 (GRCm39) splice site probably null
R4761:Abcc8 UTSW 7 45,762,499 (GRCm39) missense probably damaging 1.00
R4816:Abcc8 UTSW 7 45,754,131 (GRCm39) missense probably benign 0.01
R4841:Abcc8 UTSW 7 45,800,252 (GRCm39) missense probably damaging 1.00
R4842:Abcc8 UTSW 7 45,800,252 (GRCm39) missense probably damaging 1.00
R4870:Abcc8 UTSW 7 45,756,683 (GRCm39) nonsense probably null
R4969:Abcc8 UTSW 7 45,754,943 (GRCm39) missense probably benign 0.02
R4975:Abcc8 UTSW 7 45,800,291 (GRCm39) missense probably damaging 0.98
R5258:Abcc8 UTSW 7 45,806,572 (GRCm39) missense probably benign 0.17
R5258:Abcc8 UTSW 7 45,757,811 (GRCm39) missense probably benign
R5502:Abcc8 UTSW 7 45,758,262 (GRCm39) missense probably benign 0.00
R5518:Abcc8 UTSW 7 45,769,873 (GRCm39) missense probably benign
R5660:Abcc8 UTSW 7 45,757,828 (GRCm39) missense probably benign 0.15
R5902:Abcc8 UTSW 7 45,764,463 (GRCm39) missense probably benign
R6023:Abcc8 UTSW 7 45,757,843 (GRCm39) missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 45,816,424 (GRCm39) missense probably benign
R6078:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
R6079:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
R6103:Abcc8 UTSW 7 45,768,445 (GRCm39) missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 45,824,874 (GRCm39) missense probably benign 0.01
R6511:Abcc8 UTSW 7 45,800,285 (GRCm39) missense possibly damaging 0.82
R7046:Abcc8 UTSW 7 45,772,364 (GRCm39) missense probably damaging 1.00
R7230:Abcc8 UTSW 7 45,766,812 (GRCm39) missense probably benign
R7287:Abcc8 UTSW 7 45,762,534 (GRCm39) missense probably damaging 1.00
R7292:Abcc8 UTSW 7 45,784,950 (GRCm39) missense probably benign
R7299:Abcc8 UTSW 7 45,754,922 (GRCm39) missense possibly damaging 0.62
R7411:Abcc8 UTSW 7 45,815,341 (GRCm39) critical splice donor site probably null
R7693:Abcc8 UTSW 7 45,827,968 (GRCm39) missense probably damaging 0.99
R7704:Abcc8 UTSW 7 45,756,068 (GRCm39) missense probably damaging 0.98
R7911:Abcc8 UTSW 7 45,803,860 (GRCm39) missense probably damaging 1.00
R7947:Abcc8 UTSW 7 45,754,886 (GRCm39) critical splice donor site probably null
R8089:Abcc8 UTSW 7 45,757,780 (GRCm39) missense probably benign 0.00
R8120:Abcc8 UTSW 7 45,786,108 (GRCm39) missense probably benign 0.01
R8394:Abcc8 UTSW 7 45,803,977 (GRCm39) missense probably benign 0.03
R8731:Abcc8 UTSW 7 45,803,986 (GRCm39) missense probably damaging 0.98
R8848:Abcc8 UTSW 7 45,766,769 (GRCm39) missense possibly damaging 0.69
R8938:Abcc8 UTSW 7 45,816,418 (GRCm39) missense
R9246:Abcc8 UTSW 7 45,774,289 (GRCm39) missense probably benign 0.00
R9293:Abcc8 UTSW 7 45,756,092 (GRCm39) missense probably benign 0.00
R9476:Abcc8 UTSW 7 45,819,270 (GRCm39) missense possibly damaging 0.92
R9516:Abcc8 UTSW 7 45,787,429 (GRCm39) missense probably benign 0.30
R9541:Abcc8 UTSW 7 45,801,079 (GRCm39) missense probably benign 0.04
R9701:Abcc8 UTSW 7 45,786,054 (GRCm39) missense probably benign
R9802:Abcc8 UTSW 7 45,786,054 (GRCm39) missense probably benign
U15987:Abcc8 UTSW 7 45,755,268 (GRCm39) missense probably benign 0.01
Z1088:Abcc8 UTSW 7 45,787,489 (GRCm39) missense probably benign
Z1176:Abcc8 UTSW 7 45,756,389 (GRCm39) missense possibly damaging 0.76
Z1177:Abcc8 UTSW 7 45,803,933 (GRCm39) missense probably benign 0.00
Z1177:Abcc8 UTSW 7 45,772,309 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTAGCTAGACAAGGCAG -3'
(R):5'- ATGGATTCCTGTCACGTGCC -3'

Sequencing Primer
(F):5'- TAGCTAGACAAGGCAGCAACAC -3'
(R):5'- GGCTGCCTCAGTTACGTC -3'
Posted On 2017-02-28