Incidental Mutation 'R5907:Dlg2'
ID460708
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 91997371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
Predicted Effect probably benign
Transcript: ENSMUST00000074273
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107193
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107196
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152139
Predicted Effect probably benign
Transcript: ENSMUST00000231777
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1319:Dlg2 UTSW 7 92438023 missense probably damaging 0.98
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4631:Dlg2 UTSW 7 92088614 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4678:Dlg2 UTSW 7 92428580 missense possibly damaging 0.89
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5403:Dlg2 UTSW 7 92431002 missense probably damaging 1.00
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
R7808:Dlg2 UTSW 7 92431055 missense probably benign 0.01
R7818:Dlg2 UTSW 7 91940017 missense probably damaging 0.99
R7908:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
R7989:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
RF004:Dlg2 UTSW 7 90852677 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTGTGTGATAAGCCTGCTTC -3'
(R):5'- CCTCTAATGGAGAAAATGGTGC -3'

Sequencing Primer
(F):5'- GTGATAAGCCTGCTTCTCCCAG -3'
(R):5'- CCTTATTAAACACGTGGAGCTC -3'
Posted On2017-02-28