Incidental Mutation 'R5907:Phrf1'
ID 460713
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene Name PHD and ring finger domains 1
Synonyms
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140808697-140842663 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140840453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1216 (M1216K)
Ref Sequence ENSEMBL: ENSMUSP00000113195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000209899] [ENSMUST00000132540] [ENSMUST00000155123]
AlphaFold A6H619
Predicted Effect probably benign
Transcript: ENSMUST00000026571
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097952
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106023
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106027
AA Change: M1375K

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: M1375K

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122143
AA Change: M1216K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: M1216K

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122868
Predicted Effect probably benign
Transcript: ENSMUST00000123525
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect unknown
Transcript: ENSMUST00000130687
AA Change: M48K
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611
AA Change: M48K

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130852
AA Change: H236Q
Predicted Effect unknown
Transcript: ENSMUST00000142572
AA Change: M450K
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611
AA Change: M450K

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect probably benign
Transcript: ENSMUST00000209899
Predicted Effect probably benign
Transcript: ENSMUST00000132540
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 140,838,790 (GRCm39) unclassified probably benign
IGL01391:Phrf1 APN 7 140,842,394 (GRCm39) missense probably damaging 1.00
IGL01472:Phrf1 APN 7 140,836,403 (GRCm39) splice site probably benign
IGL01633:Phrf1 APN 7 140,840,413 (GRCm39) missense probably benign 0.43
IGL01808:Phrf1 APN 7 140,840,879 (GRCm39) missense probably damaging 1.00
IGL02004:Phrf1 APN 7 140,840,246 (GRCm39) missense probably benign 0.39
IGL02138:Phrf1 APN 7 140,839,196 (GRCm39) unclassified probably benign
IGL02678:Phrf1 APN 7 140,840,195 (GRCm39) missense probably damaging 1.00
IGL03077:Phrf1 APN 7 140,834,881 (GRCm39) nonsense probably null
PIT4466001:Phrf1 UTSW 7 140,838,725 (GRCm39) missense unknown
R0036:Phrf1 UTSW 7 140,841,693 (GRCm39) missense probably damaging 1.00
R0036:Phrf1 UTSW 7 140,841,693 (GRCm39) missense probably damaging 1.00
R0040:Phrf1 UTSW 7 140,823,770 (GRCm39) missense probably damaging 1.00
R0358:Phrf1 UTSW 7 140,838,217 (GRCm39) unclassified probably benign
R0445:Phrf1 UTSW 7 140,827,244 (GRCm39) utr 3 prime probably benign
R0535:Phrf1 UTSW 7 140,839,978 (GRCm39) missense probably benign 0.07
R0561:Phrf1 UTSW 7 140,834,876 (GRCm39) missense probably benign 0.00
R0940:Phrf1 UTSW 7 140,834,768 (GRCm39) splice site probably benign
R1499:Phrf1 UTSW 7 140,836,564 (GRCm39) missense probably damaging 1.00
R1511:Phrf1 UTSW 7 140,839,714 (GRCm39) unclassified probably benign
R1651:Phrf1 UTSW 7 140,817,434 (GRCm39) missense probably benign
R1691:Phrf1 UTSW 7 140,841,787 (GRCm39) nonsense probably null
R1778:Phrf1 UTSW 7 140,812,369 (GRCm39) missense probably benign 0.01
R1851:Phrf1 UTSW 7 140,820,831 (GRCm39) missense probably damaging 1.00
R2239:Phrf1 UTSW 7 140,817,605 (GRCm39) missense probably damaging 1.00
R2857:Phrf1 UTSW 7 140,839,593 (GRCm39) unclassified probably benign
R3796:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3797:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3798:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R3799:Phrf1 UTSW 7 140,839,831 (GRCm39) nonsense probably null
R4080:Phrf1 UTSW 7 140,839,633 (GRCm39) unclassified probably benign
R4081:Phrf1 UTSW 7 140,838,970 (GRCm39) unclassified probably benign
R4557:Phrf1 UTSW 7 140,838,842 (GRCm39) unclassified probably benign
R5217:Phrf1 UTSW 7 140,840,616 (GRCm39) missense probably damaging 1.00
R5218:Phrf1 UTSW 7 140,841,214 (GRCm39) missense possibly damaging 0.94
R5276:Phrf1 UTSW 7 140,839,196 (GRCm39) unclassified probably benign
R5442:Phrf1 UTSW 7 140,820,850 (GRCm39) missense probably damaging 1.00
R5501:Phrf1 UTSW 7 140,839,834 (GRCm39) missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 140,838,378 (GRCm39) unclassified probably benign
R5837:Phrf1 UTSW 7 140,839,974 (GRCm39) missense probably benign 0.34
R5996:Phrf1 UTSW 7 140,839,015 (GRCm39) unclassified probably benign
R6024:Phrf1 UTSW 7 140,838,898 (GRCm39) unclassified probably benign
R6244:Phrf1 UTSW 7 140,817,586 (GRCm39) missense probably damaging 1.00
R6512:Phrf1 UTSW 7 140,840,309 (GRCm39) missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 140,817,476 (GRCm39) missense probably damaging 0.98
R7311:Phrf1 UTSW 7 140,820,846 (GRCm39) missense unknown
R7409:Phrf1 UTSW 7 140,839,205 (GRCm39) missense unknown
R7517:Phrf1 UTSW 7 140,836,523 (GRCm39) missense unknown
R7560:Phrf1 UTSW 7 140,811,138 (GRCm39) critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 140,834,842 (GRCm39) missense unknown
R7700:Phrf1 UTSW 7 140,834,842 (GRCm39) missense unknown
R7867:Phrf1 UTSW 7 140,836,524 (GRCm39) missense unknown
R7895:Phrf1 UTSW 7 140,839,288 (GRCm39) missense unknown
R8179:Phrf1 UTSW 7 140,836,493 (GRCm39) missense unknown
R8705:Phrf1 UTSW 7 140,838,651 (GRCm39) missense unknown
R8708:Phrf1 UTSW 7 140,812,446 (GRCm39) missense unknown
R8748:Phrf1 UTSW 7 140,838,148 (GRCm39) missense unknown
R8768:Phrf1 UTSW 7 140,838,651 (GRCm39) missense unknown
R8789:Phrf1 UTSW 7 140,836,581 (GRCm39) missense unknown
R8859:Phrf1 UTSW 7 140,836,516 (GRCm39) missense unknown
R8991:Phrf1 UTSW 7 140,823,671 (GRCm39) missense unknown
R9086:Phrf1 UTSW 7 140,839,412 (GRCm39) missense unknown
R9158:Phrf1 UTSW 7 140,836,466 (GRCm39) missense unknown
R9287:Phrf1 UTSW 7 140,840,055 (GRCm39) missense probably benign 0.35
R9561:Phrf1 UTSW 7 140,834,815 (GRCm39) missense unknown
X0027:Phrf1 UTSW 7 140,836,481 (GRCm39) missense probably benign
Z1176:Phrf1 UTSW 7 140,838,731 (GRCm39) missense unknown
Z1176:Phrf1 UTSW 7 140,823,796 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTTCTCCTGAGAGTACAGAC -3'
(R):5'- GGGCAGGACAAACTCACTTG -3'

Sequencing Primer
(F):5'- GTACAGACTCCTCCCCTGAGAGAG -3'
(R):5'- GGACAAACTCACTTGGATCTCTG -3'
Posted On 2017-02-28