Incidental Mutation 'R5907:Nup133'
ID 460720
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Name nucleoporin 133
Synonyms mermaid, 4832420O05Rik
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5907 (G1)
Quality Score 223
Status Validated
Chromosome 8
Chromosomal Location 123897123-123949265 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123916299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 761 (Y761H)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
AlphaFold Q8R0G9
Predicted Effect possibly damaging
Transcript: ENSMUST00000044795
AA Change: Y761H

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: Y761H

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213089
Meta Mutation Damage Score 0.2957 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Cadenza UTSW 8 123911888 frame shift probably null
Gangen UTSW 8 123916282 critical splice donor site probably null
hochzeit UTSW 8 123929343 missense probably benign 0.00
low_road UTSW 8 123904579 missense probably damaging 1.00
Pathway UTSW 8 123917446 missense possibly damaging 0.82
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8703:Nup133 UTSW 8 123916282 critical splice donor site probably null
R8811:Nup133 UTSW 8 123911888 frame shift probably null
R8813:Nup133 UTSW 8 123911888 frame shift probably null
R8952:Nup133 UTSW 8 123907761 missense probably damaging 1.00
R9116:Nup133 UTSW 8 123933416 missense probably benign 0.00
R9340:Nup133 UTSW 8 123938142 missense probably benign 0.38
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGGTGCATCATAAGTCC -3'
(R):5'- CCTTAGGCACAGTGTATGACAG -3'

Sequencing Primer
(F):5'- ATCTCTGAGATTGAGGCCAGC -3'
(R):5'- ACAGAAAGAGATTAACTGGATTGTAC -3'
Posted On 2017-02-28