Incidental Mutation 'R5907:Ubl5'
ID 460721
Institutional Source Beutler Lab
Gene Symbol Ubl5
Ensembl Gene ENSMUSG00000084786
Gene Name ubiquitin-like 5
Synonyms BEACON, Ubl5a, 1110030M22Rik
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20554174-20558436 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to A at 20557830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086458] [ENSMUST00000086459] [ENSMUST00000129414] [ENSMUST00000131128] [ENSMUST00000131343] [ENSMUST00000148631] [ENSMUST00000161882] [ENSMUST00000160124] [ENSMUST00000160874] [ENSMUST00000161486] [ENSMUST00000160682] [ENSMUST00000151861] [ENSMUST00000155301] [ENSMUST00000162303] [ENSMUST00000161887]
AlphaFold Q9EPV8
Predicted Effect probably benign
Transcript: ENSMUST00000086458
SMART Domains Protein: ENSMUSP00000083649
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086459
SMART Domains Protein: ENSMUSP00000083650
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
SCOP:d1fqva2 103 291 5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129414
SMART Domains Protein: ENSMUSP00000123971
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 2 71 6.3e-7 PFAM
Pfam:ubiquitin 8 73 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131128
SMART Domains Protein: ENSMUSP00000115058
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131343
Predicted Effect probably benign
Transcript: ENSMUST00000148631
SMART Domains Protein: ENSMUSP00000119124
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
SCOP:d1fqva2 103 291 5e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161882
AA Change: D73N
SMART Domains Protein: ENSMUSP00000125540
Gene: ENSMUSG00000084786
AA Change: D73N

DomainStartEndE-ValueType
PDB:1UH6|A 1 113 5e-41 PDB
Blast:UBQ 2 113 1e-30 BLAST
SCOP:d1j8ca_ 12 60 3e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153154
Predicted Effect probably benign
Transcript: ENSMUST00000160124
SMART Domains Protein: ENSMUSP00000125364
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 2 71 6.3e-7 PFAM
Pfam:ubiquitin 8 73 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160874
Predicted Effect probably benign
Transcript: ENSMUST00000161486
SMART Domains Protein: ENSMUSP00000124506
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
PDB:1UH6|A 1 50 4e-27 PDB
Blast:UBQ 2 49 4e-21 BLAST
SCOP:d1j8ca_ 12 46 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160682
SMART Domains Protein: ENSMUSP00000124672
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 2 71 6.3e-7 PFAM
Pfam:ubiquitin 8 73 7.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161834
SMART Domains Protein: ENSMUSP00000133396
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Blast:UBQ 27 58 7e-8 BLAST
PDB:1P0R|A 27 58 3e-12 PDB
SCOP:d1j8ca_ 29 54 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151861
SMART Domains Protein: ENSMUSP00000121429
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155301
SMART Domains Protein: ENSMUSP00000118369
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
low complexity region 65 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162303
SMART Domains Protein: ENSMUSP00000124812
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 2 71 6.3e-7 PFAM
Pfam:ubiquitin 8 73 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161887
SMART Domains Protein: ENSMUSP00000123843
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
PDB:1UH6|A 1 56 7e-36 PDB
Blast:UBQ 2 56 2e-27 BLAST
SCOP:d1j8ca_ 12 56 1e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Ubl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Ubl5 APN 9 20,556,923 (GRCm39) nonsense probably null
R2307:Ubl5 UTSW 9 20,557,876 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAACCTGAGGATGAGCATTTAAG -3'
(R):5'- TCTCACACAAGTATGACAGCAG -3'

Sequencing Primer
(F):5'- AAGAAAATGTATTGTTGTGTGTGTG -3'
(R):5'- CATCTACACCAGTGTCAGATGAGG -3'
Posted On 2017-02-28