Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Itga7'

460725

Institutional Source

Beutler Lab

Gene Symbol

Itga7

Ensembl Gene

ENSMUSG00000025348

Gene Name

integrin alpha 7

Synonyms

[a]7, alpha7

MMRRC Submission

044104-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.308) question?

Stock #

R5907 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

128933818-128958282 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128942981 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 326 (Y326H)

Ref Sequence

ENSEMBL: ENSMUSP00000151960 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000218290]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099112
AA Change: Y322H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: Y322H

Domain	Start	End	E-Value	Type
Int_alpha	48	110	4.11e-6	SMART
Int_alpha	259	312	3.72e-4	SMART
Int_alpha	316	372	1.16e-14	SMART
Int_alpha	377	430	9.21e-18	SMART
Int_alpha	435	490	4.38e-1	SMART
low complexity region	510	523	N/A	INTRINSIC
SCOP:d1m1xa3	807	1039	6e-50	SMART
low complexity region	1041	1058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158143

Predicted Effect

probably damaging
Transcript: ENSMUST00000218290
AA Change: Y326H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218387

Meta Mutation Damage Score

0.6119

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adamts16	C	A	13: 70,728,910	C1204F	probably damaging	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dopey2	A	T	16: 93,801,581	H1878L	probably damaging	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Ift140	A	G	17: 25,092,371	D1180G	probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga4	C	T	2: 79,322,656	H896Y	probably benign	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Rpe65	T	C	3: 159,615,682		probably null	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Itga7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Itga7	APN	10	128941854	missense	possibly damaging	0.67
IGL00809:Itga7	APN	10	128939169	critical splice donor site	probably null
IGL01448:Itga7	APN	10	128949468	nonsense	probably null
IGL01675:Itga7	APN	10	128946855	missense	probably damaging	1.00
IGL02158:Itga7	APN	10	128953782	missense	possibly damaging	0.95
IGL02475:Itga7	APN	10	128934089	missense	probably damaging	1.00
IGL02689:Itga7	APN	10	128946818	missense	possibly damaging	0.83
IGL02946:Itga7	APN	10	128934083	missense	probably benign
IGL03223:Itga7	APN	10	128948811	unclassified	probably benign
R0662:Itga7	UTSW	10	128953531	missense	probably damaging	1.00
R0972:Itga7	UTSW	10	128942877	missense	probably damaging	0.98
R1449:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R1521:Itga7	UTSW	10	128957811	missense	possibly damaging	0.63
R1597:Itga7	UTSW	10	128946863	missense	probably benign	0.17
R1651:Itga7	UTSW	10	128948824	missense	probably benign	0.01
R4718:Itga7	UTSW	10	128940734	frame shift	probably null
R5011:Itga7	UTSW	10	128949447	missense	possibly damaging	0.51
R5151:Itga7	UTSW	10	128944511	missense	possibly damaging	0.91
R5287:Itga7	UTSW	10	128943158	missense	probably benign	0.38
R5419:Itga7	UTSW	10	128944033	missense	probably null	0.06
R6165:Itga7	UTSW	10	128942935	missense	probably benign	0.16
R6189:Itga7	UTSW	10	128950403	missense	possibly damaging	0.76
R6263:Itga7	UTSW	10	128944086	missense	probably benign
R6612:Itga7	UTSW	10	128948993	missense	possibly damaging	0.65
R6746:Itga7	UTSW	10	128949472	missense	probably benign	0.13
R6850:Itga7	UTSW	10	128945516	missense	probably damaging	1.00
R7226:Itga7	UTSW	10	128940932	missense	probably damaging	0.98
R7257:Itga7	UTSW	10	128944413	missense	possibly damaging	0.55
R7344:Itga7	UTSW	10	128940929	missense	possibly damaging	0.63
R7456:Itga7	UTSW	10	128941936	missense	probably damaging	1.00
R7545:Itga7	UTSW	10	128933906	start gained	probably benign
R7643:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R7644:Itga7	UTSW	10	128953501	missense	probably benign	0.13
R7822:Itga7	UTSW	10	128942966	missense	probably benign	0.00
R7998:Itga7	UTSW	10	128934151	missense	probably damaging	1.00
R9417:Itga7	UTSW	10	128957674	missense	unknown
R9563:Itga7	UTSW	10	128953800	missense	probably damaging	1.00
X0020:Itga7	UTSW	10	128942877	missense	probably damaging	0.98
Z1088:Itga7	UTSW	10	128949163	missense	probably benign	0.10
Z1176:Itga7	UTSW	10	128953827	missense	probably benign	0.12
Z1177:Itga7	UTSW	10	128943214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCATCGATTCTGGGAAGG -3'
(R):5'- AATGGCCACCCTGGTTCATG -3'

Sequencing Primer
(F):5'- AGGGTCTTATGCGCTCAGAAG -3'
(R):5'- GAGACAGTATGGAGCTCT -3'

Posted On

2017-02-28