Incidental Mutation 'R5907:Itga7'
ID 460725
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Name integrin alpha 7
Synonyms [a]7, alpha7
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.388) question?
Stock # R5907 (G1)
Quality Score 219
Status Validated
Chromosome 10
Chromosomal Location 128769645-128794155 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128778850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 326 (Y326H)
Ref Sequence ENSEMBL: ENSMUSP00000151960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099112] [ENSMUST00000218290]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099112
AA Change: Y322H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: Y322H

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158143
Predicted Effect probably damaging
Transcript: ENSMUST00000218290
AA Change: Y326H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218387
Meta Mutation Damage Score 0.6119 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128,777,723 (GRCm39) missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128,775,038 (GRCm39) critical splice donor site probably null
IGL01448:Itga7 APN 10 128,785,337 (GRCm39) nonsense probably null
IGL01675:Itga7 APN 10 128,782,724 (GRCm39) missense probably damaging 1.00
IGL02158:Itga7 APN 10 128,789,651 (GRCm39) missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128,769,958 (GRCm39) missense probably damaging 1.00
IGL02689:Itga7 APN 10 128,782,687 (GRCm39) missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128,769,952 (GRCm39) missense probably benign
IGL03223:Itga7 APN 10 128,784,680 (GRCm39) unclassified probably benign
R0662:Itga7 UTSW 10 128,789,400 (GRCm39) missense probably damaging 1.00
R0972:Itga7 UTSW 10 128,778,746 (GRCm39) missense probably damaging 0.98
R1449:Itga7 UTSW 10 128,789,370 (GRCm39) missense probably benign 0.13
R1521:Itga7 UTSW 10 128,793,680 (GRCm39) missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128,782,732 (GRCm39) missense probably benign 0.17
R1651:Itga7 UTSW 10 128,784,693 (GRCm39) missense probably benign 0.01
R4718:Itga7 UTSW 10 128,776,603 (GRCm39) frame shift probably null
R5011:Itga7 UTSW 10 128,785,316 (GRCm39) missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128,780,380 (GRCm39) missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128,779,027 (GRCm39) missense probably benign 0.38
R5419:Itga7 UTSW 10 128,779,902 (GRCm39) missense probably null 0.06
R6165:Itga7 UTSW 10 128,778,804 (GRCm39) missense probably benign 0.16
R6189:Itga7 UTSW 10 128,786,272 (GRCm39) missense possibly damaging 0.76
R6263:Itga7 UTSW 10 128,779,955 (GRCm39) missense probably benign
R6612:Itga7 UTSW 10 128,784,862 (GRCm39) missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128,785,341 (GRCm39) missense probably benign 0.13
R6850:Itga7 UTSW 10 128,781,385 (GRCm39) missense probably damaging 1.00
R7226:Itga7 UTSW 10 128,776,801 (GRCm39) missense probably damaging 0.98
R7257:Itga7 UTSW 10 128,780,282 (GRCm39) missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128,776,798 (GRCm39) missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128,777,805 (GRCm39) missense probably damaging 1.00
R7545:Itga7 UTSW 10 128,769,775 (GRCm39) start gained probably benign
R7643:Itga7 UTSW 10 128,789,370 (GRCm39) missense probably benign 0.13
R7644:Itga7 UTSW 10 128,789,370 (GRCm39) missense probably benign 0.13
R7822:Itga7 UTSW 10 128,778,835 (GRCm39) missense probably benign 0.00
R7998:Itga7 UTSW 10 128,770,020 (GRCm39) missense probably damaging 1.00
R9417:Itga7 UTSW 10 128,793,543 (GRCm39) missense unknown
R9563:Itga7 UTSW 10 128,789,669 (GRCm39) missense probably damaging 1.00
X0020:Itga7 UTSW 10 128,778,746 (GRCm39) missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128,785,032 (GRCm39) missense probably benign 0.10
Z1176:Itga7 UTSW 10 128,789,696 (GRCm39) missense probably benign 0.12
Z1177:Itga7 UTSW 10 128,779,083 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATCGATTCTGGGAAGG -3'
(R):5'- AATGGCCACCCTGGTTCATG -3'

Sequencing Primer
(F):5'- AGGGTCTTATGCGCTCAGAAG -3'
(R):5'- GAGACAGTATGGAGCTCT -3'
Posted On 2017-02-28