Incidental Mutation 'R5907:Mtmr4'
ID460728
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87612050 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 920 (W920R)
Ref Sequence ENSEMBL: ENSMUSP00000090478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628]
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: W920R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: W920R

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103179
AA Change: W977R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: W977R

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119628
AA Change: W977R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: W977R

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,066,150 D559E probably benign Het
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCATTCCCAAGCGGAGAGAC -3'
(R):5'- TCATCTGAAGCTCTCGAACC -3'

Sequencing Primer
(F):5'- AGAGACCACTCCTCGGC -3'
(R):5'- AACCTGTCGCCGTAGCTG -3'
Posted On2017-02-28