Incidental Mutation 'R5907:Snx6'
ID 460730
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Name sorting nexin 6
Synonyms 2010006G21Rik, 2610032J07Rik, 2810425K19Rik
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.835) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54793124-54842464 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54801104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 298 (Y298H)
Ref Sequence ENSEMBL: ENSMUSP00000005798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934]
AlphaFold Q6P8X1
Predicted Effect probably damaging
Transcript: ENSMUST00000005798
AA Change: Y298H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: Y298H

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218934
AA Change: Y182H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219722
Meta Mutation Damage Score 0.5633 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phf8-ps G T 17: 33,285,124 (GRCm39) D559E probably benign Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54,801,094 (GRCm39) missense probably damaging 0.99
IGL02682:Snx6 APN 12 54,801,130 (GRCm39) missense probably damaging 1.00
IGL02995:Snx6 APN 12 54,842,295 (GRCm39) splice site probably benign
IGL03240:Snx6 APN 12 54,830,228 (GRCm39) missense probably damaging 0.98
IGL03353:Snx6 APN 12 54,812,469 (GRCm39) splice site probably benign
PIT4362001:Snx6 UTSW 12 54,814,815 (GRCm39) missense possibly damaging 0.80
R0458:Snx6 UTSW 12 54,814,921 (GRCm39) nonsense probably null
R0610:Snx6 UTSW 12 54,798,574 (GRCm39) missense probably damaging 1.00
R0689:Snx6 UTSW 12 54,810,441 (GRCm39) missense probably benign 0.00
R1818:Snx6 UTSW 12 54,830,259 (GRCm39) missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54,830,259 (GRCm39) missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54,817,528 (GRCm39) missense probably damaging 1.00
R5275:Snx6 UTSW 12 54,830,807 (GRCm39) missense probably damaging 1.00
R5373:Snx6 UTSW 12 54,817,513 (GRCm39) missense probably damaging 0.99
R5374:Snx6 UTSW 12 54,817,513 (GRCm39) missense probably damaging 0.99
R5497:Snx6 UTSW 12 54,803,846 (GRCm39) missense probably damaging 0.98
R5947:Snx6 UTSW 12 54,817,549 (GRCm39) nonsense probably null
R6178:Snx6 UTSW 12 54,807,249 (GRCm39) missense probably damaging 0.99
R6287:Snx6 UTSW 12 54,793,813 (GRCm39) missense possibly damaging 0.75
R6321:Snx6 UTSW 12 54,798,798 (GRCm39) missense probably damaging 1.00
R6878:Snx6 UTSW 12 54,810,386 (GRCm39) splice site probably null
R7055:Snx6 UTSW 12 54,830,864 (GRCm39) missense probably damaging 1.00
R8227:Snx6 UTSW 12 54,798,756 (GRCm39) missense possibly damaging 0.82
R8899:Snx6 UTSW 12 54,812,423 (GRCm39) missense probably benign 0.06
R9606:Snx6 UTSW 12 54,814,811 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CTTGCTCCAGGAAAGTTACTTTC -3'
(R):5'- GCCATTGCAGTAGATTCTATAATGG -3'

Sequencing Primer
(F):5'- GCCAAGATAGCCTCACATTCATTTC -3'
(R):5'- GCAGTAGATTCTATAATGGTGAAGC -3'
Posted On 2017-02-28