Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Ift140'

460749

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

044104-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5907 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25092371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1180 (D1180G)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: D1180G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: D1180G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: D1180G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: D1180G

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139300

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adamts16	C	A	13: 70,728,910	C1204F	probably damaging	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dopey2	A	T	16: 93,801,581	H1878L	probably damaging	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga4	C	T	2: 79,322,656	H896Y	probably benign	Het
Itga7	T	C	10: 128,942,981	Y326H	probably damaging	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Rpe65	T	C	3: 159,615,682		probably null	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03
R9782:Ift140	UTSW	17	25045177	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTCTGACTCAGCCTCGTG -3'
(R):5'- TATATGCCCAGATGCCCAAC -3'

Sequencing Primer
(F):5'- TGACTCAGCCTCGTGCAGTAG -3'
(R):5'- CATATGGCCCAGTTGAGATATACTGG -3'

Posted On

2017-02-28