Incidental Mutation 'R5907:Phf8-ps'
ID 460752
Institutional Source Beutler Lab
Gene Symbol Phf8-ps
Ensembl Gene ENSMUSG00000023350
Gene Name PHD finger protein 8, pseudogene
Synonyms 4921501E09Rik
MMRRC Submission 044104-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R5907 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33283117-33286999 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33285124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 559 (D559E)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024121
AA Change: D559E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: D559E

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,218,120 (GRCm39) I206N probably damaging Het
Aadac T A 3: 59,947,248 (GRCm39) D315E probably damaging Het
Abcc8 A G 7: 45,773,330 (GRCm39) F800L probably benign Het
Adamts16 C A 13: 70,877,029 (GRCm39) C1204F probably damaging Het
Adcy7 A G 8: 89,038,856 (GRCm39) T291A possibly damaging Het
AI182371 G T 2: 34,976,134 (GRCm39) Q255K possibly damaging Het
Aig1 A T 10: 13,677,528 (GRCm39) probably benign Het
Ak5 T C 3: 152,321,589 (GRCm39) D266G probably damaging Het
Ank1 A T 8: 23,630,220 (GRCm39) E93D probably damaging Het
Bop1 T C 15: 76,340,117 (GRCm39) D153G probably damaging Het
Bub1 G T 2: 127,661,142 (GRCm39) N316K probably benign Het
Capn1 T C 19: 6,047,827 (GRCm39) N412S probably benign Het
Cdca4 A G 12: 112,785,339 (GRCm39) S130P probably benign Het
Cdh23 A T 10: 60,264,158 (GRCm39) D663E probably damaging Het
Clca3a1 T C 3: 144,455,403 (GRCm39) probably benign Het
Csmd2 C T 4: 128,091,178 (GRCm39) P239L probably damaging Het
Dlg2 A T 7: 91,646,579 (GRCm39) probably benign Het
Dnpep C T 1: 75,288,635 (GRCm39) probably null Het
Dop1b A T 16: 93,598,469 (GRCm39) H1878L probably damaging Het
Dscam C T 16: 96,622,120 (GRCm39) D444N probably damaging Het
Emc9 C T 14: 55,819,569 (GRCm39) probably null Het
Ero1b T A 13: 12,615,207 (GRCm39) I346N probably damaging Het
Etv3 A G 3: 87,442,850 (GRCm39) T145A probably benign Het
Fam170a T A 18: 50,415,321 (GRCm39) probably null Het
Fap A T 2: 62,374,700 (GRCm39) I261N probably damaging Het
Fbn2 T C 18: 58,178,409 (GRCm39) N1943S probably damaging Het
Glb1l3 A T 9: 26,737,679 (GRCm39) V466E probably damaging Het
Gm10521 A T 1: 171,724,070 (GRCm39) H127L unknown Het
Gm8186 G T 17: 26,318,130 (GRCm39) N22K probably damaging Het
Gpr132 A C 12: 112,815,717 (GRCm39) L370V probably benign Het
Hectd1 A T 12: 51,845,537 (GRCm39) H449Q probably damaging Het
Hook3 A G 8: 26,534,306 (GRCm39) probably benign Het
Ift140 A G 17: 25,311,345 (GRCm39) D1180G probably benign Het
Isoc2b A T 7: 4,852,577 (GRCm39) probably null Het
Itga4 C T 2: 79,153,000 (GRCm39) H896Y probably benign Het
Itga7 T C 10: 128,778,850 (GRCm39) Y326H probably damaging Het
Itpr3 A T 17: 27,336,867 (GRCm39) E2397V probably damaging Het
Jtb T G 3: 90,142,884 (GRCm39) probably null Het
Klk15 A G 7: 43,588,183 (GRCm39) T164A probably benign Het
Kmt2e C A 5: 23,669,704 (GRCm39) H64N probably damaging Het
Lamtor3 T A 3: 137,633,054 (GRCm39) probably benign Het
Laptm4b A G 15: 34,258,830 (GRCm39) I35V possibly damaging Het
Lrrc1 A C 9: 77,341,379 (GRCm39) L393R probably damaging Het
Ltn1 A G 16: 87,178,391 (GRCm39) S1613P possibly damaging Het
Mtmr4 T A 11: 87,502,876 (GRCm39) W920R probably damaging Het
Nbeal1 T C 1: 60,267,950 (GRCm39) probably benign Het
Nup133 A G 8: 124,643,038 (GRCm39) Y761H possibly damaging Het
Nwd2 T A 5: 63,963,326 (GRCm39) V970D probably damaging Het
Or4c126 A G 2: 89,824,301 (GRCm39) H188R probably benign Het
Or6n1 T C 1: 173,916,785 (GRCm39) Y60H probably benign Het
Or8k24 A T 2: 86,216,218 (GRCm39) S181R probably damaging Het
Osbp C T 19: 11,951,240 (GRCm39) L262F probably damaging Het
Phldb2 G T 16: 45,645,551 (GRCm39) D343E probably damaging Het
Phrf1 T A 7: 140,840,453 (GRCm39) M1216K possibly damaging Het
Phyh A T 2: 4,935,462 (GRCm39) probably null Het
Plekhf1 A T 7: 37,921,594 (GRCm39) probably null Het
Rars1 T C 11: 35,719,475 (GRCm39) N116D probably damaging Het
Rnf44 T A 13: 54,830,621 (GRCm39) Q181L possibly damaging Het
Rpe65 T C 3: 159,321,319 (GRCm39) probably null Het
Scaf1 A G 7: 44,663,016 (GRCm39) probably benign Het
Serpinb11 A T 1: 107,299,919 (GRCm39) R88S probably benign Het
Slc7a7 T C 14: 54,616,560 (GRCm39) N174S probably damaging Het
Slc9a5 T C 8: 106,083,807 (GRCm39) probably null Het
Slfn1 C A 11: 83,012,002 (GRCm39) N39K possibly damaging Het
Snx20 G A 8: 89,353,923 (GRCm39) A269V possibly damaging Het
Snx6 A G 12: 54,801,104 (GRCm39) Y298H probably damaging Het
Stk32c C T 7: 138,700,590 (GRCm39) R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 (GRCm39) I190F probably damaging Het
Ube2d2b T A 5: 107,978,498 (GRCm39) F50I probably damaging Het
Ubl5 G A 9: 20,557,830 (GRCm39) probably benign Het
Ubqln5 T G 7: 103,777,781 (GRCm39) T348P possibly damaging Het
Usp46 T C 5: 74,197,746 (GRCm39) D22G probably benign Het
Vars1 A G 17: 35,231,352 (GRCm39) N655S probably damaging Het
Vmn2r103 A C 17: 20,032,715 (GRCm39) I830L possibly damaging Het
Vmn2r26 T A 6: 124,016,830 (GRCm39) N431K probably benign Het
Vmn2r4 G T 3: 64,298,487 (GRCm39) P547Q probably damaging Het
Yy1 T A 12: 108,772,354 (GRCm39) probably benign Het
Zbtb2 A T 10: 4,318,592 (GRCm39) L478Q possibly damaging Het
Zfp12 T C 5: 143,225,743 (GRCm39) F17S probably damaging Het
Zfp219 T A 14: 52,244,606 (GRCm39) probably null Het
Zfp629 G A 7: 127,209,542 (GRCm39) H756Y probably damaging Het
Zfp748 T C 13: 67,689,292 (GRCm39) K656R possibly damaging Het
Zfp958 T A 8: 4,679,072 (GRCm39) Y366N probably benign Het
Zp3 C T 5: 136,017,377 (GRCm39) T396I probably benign Het
Other mutations in Phf8-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Phf8-ps APN 17 33,284,837 (GRCm39) missense probably benign 0.10
IGL00790:Phf8-ps APN 17 33,286,361 (GRCm39) missense probably damaging 1.00
IGL01146:Phf8-ps APN 17 33,284,357 (GRCm39) missense possibly damaging 0.68
IGL01755:Phf8-ps APN 17 33,285,951 (GRCm39) missense probably damaging 0.99
IGL01880:Phf8-ps APN 17 33,285,690 (GRCm39) missense probably damaging 0.99
IGL01981:Phf8-ps APN 17 33,286,628 (GRCm39) missense probably damaging 1.00
IGL01982:Phf8-ps APN 17 33,285,289 (GRCm39) missense probably benign 0.00
IGL02047:Phf8-ps APN 17 33,286,275 (GRCm39) missense probably damaging 1.00
IGL02070:Phf8-ps APN 17 33,285,104 (GRCm39) missense probably damaging 0.98
R0055:Phf8-ps UTSW 17 33,285,696 (GRCm39) missense probably damaging 1.00
R0055:Phf8-ps UTSW 17 33,285,696 (GRCm39) missense probably damaging 1.00
R0893:Phf8-ps UTSW 17 33,284,263 (GRCm39) missense probably benign 0.34
R1528:Phf8-ps UTSW 17 33,286,215 (GRCm39) missense probably damaging 1.00
R1558:Phf8-ps UTSW 17 33,284,679 (GRCm39) missense probably benign 0.20
R1664:Phf8-ps UTSW 17 33,285,492 (GRCm39) missense probably damaging 1.00
R1782:Phf8-ps UTSW 17 33,286,662 (GRCm39) missense probably benign 0.06
R1881:Phf8-ps UTSW 17 33,284,258 (GRCm39) missense probably damaging 1.00
R2018:Phf8-ps UTSW 17 33,285,941 (GRCm39) missense probably benign 0.15
R2029:Phf8-ps UTSW 17 33,286,598 (GRCm39) nonsense probably null
R2152:Phf8-ps UTSW 17 33,285,908 (GRCm39) missense probably damaging 1.00
R2298:Phf8-ps UTSW 17 33,285,752 (GRCm39) missense probably damaging 1.00
R2395:Phf8-ps UTSW 17 33,284,936 (GRCm39) missense probably benign 0.28
R2424:Phf8-ps UTSW 17 33,284,730 (GRCm39) missense probably benign 0.00
R3973:Phf8-ps UTSW 17 33,285,405 (GRCm39) missense probably benign 0.24
R3976:Phf8-ps UTSW 17 33,285,405 (GRCm39) missense probably benign 0.24
R4159:Phf8-ps UTSW 17 33,285,023 (GRCm39) missense probably benign 0.01
R4160:Phf8-ps UTSW 17 33,285,023 (GRCm39) missense probably benign 0.01
R4161:Phf8-ps UTSW 17 33,285,023 (GRCm39) missense probably benign 0.01
R4761:Phf8-ps UTSW 17 33,286,172 (GRCm39) missense probably damaging 1.00
R4855:Phf8-ps UTSW 17 33,285,713 (GRCm39) missense probably benign 0.00
R5039:Phf8-ps UTSW 17 33,286,734 (GRCm39) missense probably damaging 1.00
R5255:Phf8-ps UTSW 17 33,285,739 (GRCm39) nonsense probably null
R5383:Phf8-ps UTSW 17 33,284,231 (GRCm39) missense probably benign
R5520:Phf8-ps UTSW 17 33,284,367 (GRCm39) missense probably benign 0.03
R5588:Phf8-ps UTSW 17 33,285,249 (GRCm39) nonsense probably null
R5685:Phf8-ps UTSW 17 33,285,746 (GRCm39) missense probably benign 0.04
R5826:Phf8-ps UTSW 17 33,284,288 (GRCm39) missense possibly damaging 0.87
R6397:Phf8-ps UTSW 17 33,285,219 (GRCm39) missense probably benign 0.28
R6731:Phf8-ps UTSW 17 33,285,200 (GRCm39) missense probably benign 0.02
R6750:Phf8-ps UTSW 17 33,285,372 (GRCm39) missense possibly damaging 0.82
R7043:Phf8-ps UTSW 17 33,284,306 (GRCm39) missense possibly damaging 0.85
R7242:Phf8-ps UTSW 17 33,286,101 (GRCm39) missense probably damaging 1.00
R7262:Phf8-ps UTSW 17 33,285,971 (GRCm39) missense probably damaging 0.99
R7265:Phf8-ps UTSW 17 33,285,971 (GRCm39) missense probably damaging 0.99
R7286:Phf8-ps UTSW 17 33,284,501 (GRCm39) missense probably benign
R7797:Phf8-ps UTSW 17 33,286,664 (GRCm39) missense probably damaging 1.00
R8314:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8315:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8376:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8377:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8378:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8404:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8405:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8406:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8425:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8501:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R8502:Phf8-ps UTSW 17 33,286,038 (GRCm39) missense probably benign 0.04
R9091:Phf8-ps UTSW 17 33,286,701 (GRCm39) missense probably damaging 1.00
R9220:Phf8-ps UTSW 17 33,286,494 (GRCm39) missense probably benign 0.26
R9270:Phf8-ps UTSW 17 33,286,701 (GRCm39) missense probably damaging 1.00
R9369:Phf8-ps UTSW 17 33,285,579 (GRCm39) missense probably damaging 1.00
R9766:Phf8-ps UTSW 17 33,285,647 (GRCm39) missense probably damaging 0.99
Z1176:Phf8-ps UTSW 17 33,284,631 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACATGGGGCAAACTTGG -3'
(R):5'- AGGCAAGCTCATCCCACTTC -3'

Sequencing Primer
(F):5'- GCAAACTTGGAGGAATTTTTGGTC -3'
(R):5'- TGCCCTCCAAAAATGGTTCAG -3'
Posted On 2017-02-28