Incidental Mutation 'R5907:4921501E09Rik'
ID460752
Institutional Source Beutler Lab
Gene Symbol 4921501E09Rik
Ensembl Gene ENSMUSG00000023350
Gene NameRIKEN cDNA 4921501E09 gene
Synonyms
MMRRC Submission 044104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5907 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33064143-33068058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33066150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 559 (D559E)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
Predicted Effect probably benign
Transcript: ENSMUST00000024121
AA Change: D559E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: D559E

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 93% (92/99)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,306,822 I206N probably damaging Het
Aadac T A 3: 60,039,827 D315E probably damaging Het
Abcc8 A G 7: 46,123,906 F800L probably benign Het
Adamts16 C A 13: 70,728,910 C1204F probably damaging Het
Adcy7 A G 8: 88,312,228 T291A possibly damaging Het
AI182371 G T 2: 35,086,122 Q255K possibly damaging Het
Aig1 A T 10: 13,801,784 probably benign Het
Ak5 T C 3: 152,615,952 D266G probably damaging Het
Ank1 A T 8: 23,140,204 E93D probably damaging Het
Bop1 T C 15: 76,455,917 D153G probably damaging Het
Bub1 G T 2: 127,819,222 N316K probably benign Het
Capn1 T C 19: 5,997,797 N412S probably benign Het
Cdca4 A G 12: 112,821,719 S130P probably benign Het
Cdh23 A T 10: 60,428,379 D663E probably damaging Het
Clca3a1 T C 3: 144,749,642 probably benign Het
Csmd2 C T 4: 128,197,385 P239L probably damaging Het
Dlg2 A T 7: 91,997,371 probably benign Het
Dnpep C T 1: 75,311,991 probably null Het
Dopey2 A T 16: 93,801,581 H1878L probably damaging Het
Dscam C T 16: 96,820,920 D444N probably damaging Het
Emc9 C T 14: 55,582,112 probably null Het
Ero1lb T A 13: 12,600,318 I346N probably damaging Het
Etv3 A G 3: 87,535,543 T145A probably benign Het
Fam170a T A 18: 50,282,254 probably null Het
Fap A T 2: 62,544,356 I261N probably damaging Het
Fbn2 T C 18: 58,045,337 N1943S probably damaging Het
Glb1l3 A T 9: 26,826,383 V466E probably damaging Het
Gm10521 A T 1: 171,896,503 H127L unknown Het
Gm8186 G T 17: 26,099,156 N22K probably damaging Het
Gpr132 A C 12: 112,852,097 L370V probably benign Het
Hectd1 A T 12: 51,798,754 H449Q probably damaging Het
Hook3 A G 8: 26,044,278 probably benign Het
Ift140 A G 17: 25,092,371 D1180G probably benign Het
Isoc2b A T 7: 4,849,578 probably null Het
Itga4 C T 2: 79,322,656 H896Y probably benign Het
Itga7 T C 10: 128,942,981 Y326H probably damaging Het
Itpr3 A T 17: 27,117,893 E2397V probably damaging Het
Jtb T G 3: 90,235,577 probably null Het
Klk15 A G 7: 43,938,759 T164A probably benign Het
Kmt2e C A 5: 23,464,706 H64N probably damaging Het
Lamtor3 T A 3: 137,927,293 probably benign Het
Laptm4b A G 15: 34,258,684 I35V possibly damaging Het
Lrrc1 A C 9: 77,434,097 L393R probably damaging Het
Ltn1 A G 16: 87,381,503 S1613P possibly damaging Het
Mtmr4 T A 11: 87,612,050 W920R probably damaging Het
Nbeal1 T C 1: 60,228,791 probably benign Het
Nup133 A G 8: 123,916,299 Y761H possibly damaging Het
Nwd2 T A 5: 63,805,983 V970D probably damaging Het
Olfr1058 A T 2: 86,385,874 S181R probably damaging Het
Olfr1261 A G 2: 89,993,957 H188R probably benign Het
Olfr429 T C 1: 174,089,219 Y60H probably benign Het
Osbp C T 19: 11,973,876 L262F probably damaging Het
Phldb2 G T 16: 45,825,188 D343E probably damaging Het
Phrf1 T A 7: 141,260,540 M1216K possibly damaging Het
Phyh A T 2: 4,930,651 probably null Het
Plekhf1 A T 7: 38,222,170 probably null Het
Rars T C 11: 35,828,648 N116D probably damaging Het
Rnf44 T A 13: 54,682,808 Q181L possibly damaging Het
Rpe65 T C 3: 159,615,682 probably null Het
Scaf1 A G 7: 45,013,592 probably benign Het
Serpinb11 A T 1: 107,372,189 R88S probably benign Het
Slc7a7 T C 14: 54,379,103 N174S probably damaging Het
Slc9a5 T C 8: 105,357,175 probably null Het
Slfn1 C A 11: 83,121,176 N39K possibly damaging Het
Snx20 G A 8: 88,627,295 A269V possibly damaging Het
Snx6 A G 12: 54,754,319 Y298H probably damaging Het
Stk32c C T 7: 139,120,674 R213Q probably benign Het
Tgfbr1 A T 4: 47,396,555 I190F probably damaging Het
Ube2d2b T A 5: 107,830,632 F50I probably damaging Het
Ubl5 G A 9: 20,646,534 probably benign Het
Ubqln5 T G 7: 104,128,574 T348P possibly damaging Het
Usp46 T C 5: 74,037,085 D22G probably benign Het
Vars A G 17: 35,012,376 N655S probably damaging Het
Vmn2r103 A C 17: 19,812,453 I830L possibly damaging Het
Vmn2r26 T A 6: 124,039,871 N431K probably benign Het
Vmn2r4 G T 3: 64,391,066 P547Q probably damaging Het
Yy1 T A 12: 108,806,428 probably benign Het
Zbtb2 A T 10: 4,368,592 L478Q possibly damaging Het
Zfp12 T C 5: 143,239,988 F17S probably damaging Het
Zfp219 T A 14: 52,007,149 probably null Het
Zfp629 G A 7: 127,610,370 H756Y probably damaging Het
Zfp748 T C 13: 67,541,173 K656R possibly damaging Het
Zfp958 T A 8: 4,629,072 Y366N probably benign Het
Zp3 C T 5: 135,988,523 T396I probably benign Het
Other mutations in 4921501E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:4921501E09Rik APN 17 33065863 missense probably benign 0.10
IGL00790:4921501E09Rik APN 17 33067387 missense probably damaging 1.00
IGL01146:4921501E09Rik APN 17 33065383 missense possibly damaging 0.68
IGL01755:4921501E09Rik APN 17 33066977 missense probably damaging 0.99
IGL01880:4921501E09Rik APN 17 33066716 missense probably damaging 0.99
IGL01981:4921501E09Rik APN 17 33067654 missense probably damaging 1.00
IGL01982:4921501E09Rik APN 17 33066315 missense probably benign 0.00
IGL02047:4921501E09Rik APN 17 33067301 missense probably damaging 1.00
IGL02070:4921501E09Rik APN 17 33066130 missense probably damaging 0.98
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0893:4921501E09Rik UTSW 17 33065289 missense probably benign 0.34
R1528:4921501E09Rik UTSW 17 33067241 missense probably damaging 1.00
R1558:4921501E09Rik UTSW 17 33065705 missense probably benign 0.20
R1664:4921501E09Rik UTSW 17 33066518 missense probably damaging 1.00
R1782:4921501E09Rik UTSW 17 33067688 missense probably benign 0.06
R1881:4921501E09Rik UTSW 17 33065284 missense probably damaging 1.00
R2018:4921501E09Rik UTSW 17 33066967 missense probably benign 0.15
R2029:4921501E09Rik UTSW 17 33067624 nonsense probably null
R2152:4921501E09Rik UTSW 17 33066934 missense probably damaging 1.00
R2298:4921501E09Rik UTSW 17 33066778 missense probably damaging 1.00
R2395:4921501E09Rik UTSW 17 33065962 missense probably benign 0.28
R2424:4921501E09Rik UTSW 17 33065756 missense probably benign 0.00
R3973:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R3976:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R4159:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4160:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4161:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4761:4921501E09Rik UTSW 17 33067198 missense probably damaging 1.00
R4855:4921501E09Rik UTSW 17 33066739 missense probably benign 0.00
R5039:4921501E09Rik UTSW 17 33067760 missense probably damaging 1.00
R5255:4921501E09Rik UTSW 17 33066765 nonsense probably null
R5383:4921501E09Rik UTSW 17 33065257 missense probably benign
R5520:4921501E09Rik UTSW 17 33065393 missense probably benign 0.03
R5588:4921501E09Rik UTSW 17 33066275 nonsense probably null
R5685:4921501E09Rik UTSW 17 33066772 missense probably benign 0.04
R5826:4921501E09Rik UTSW 17 33065314 missense possibly damaging 0.87
R6397:4921501E09Rik UTSW 17 33066245 missense probably benign 0.28
R6731:4921501E09Rik UTSW 17 33066226 missense probably benign 0.02
R6750:4921501E09Rik UTSW 17 33066398 missense possibly damaging 0.82
R7043:4921501E09Rik UTSW 17 33065332 missense possibly damaging 0.85
R7242:4921501E09Rik UTSW 17 33067127 missense probably damaging 1.00
R7262:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7265:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7286:4921501E09Rik UTSW 17 33065527 missense probably benign
R7797:4921501E09Rik UTSW 17 33067690 missense probably damaging 1.00
R8314:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8315:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8376:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8377:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8378:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8404:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8405:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8406:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8425:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8501:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
R8502:4921501E09Rik UTSW 17 33067064 missense probably benign 0.04
Z1176:4921501E09Rik UTSW 17 33065657 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACATGGGGCAAACTTGG -3'
(R):5'- AGGCAAGCTCATCCCACTTC -3'

Sequencing Primer
(F):5'- GCAAACTTGGAGGAATTTTTGGTC -3'
(R):5'- TGCCCTCCAAAAATGGTTCAG -3'
Posted On2017-02-28