Incidental Mutation 'R5908:Sh3bp4'
ID 460758
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 044105-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5908 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 89070415-89155068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 89145883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 818 (S818A)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably damaging
Transcript: ENSMUST00000066279
AA Change: S818A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: S818A

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89145592 missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89153166 missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 splice site probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89145315 missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89145575 missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89152342 missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89144437 missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89144925 nonsense probably null
R9718:Sh3bp4 UTSW 1 89145750 missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Z1176:Sh3bp4 UTSW 1 89145728 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACACCAAGAACGTGCTGGTC -3'
(R):5'- ACCATAGAGGATCGGAACTGTAAC -3'

Sequencing Primer
(F):5'- TGCGGACCTTACTCATGGAGAAC -3'
(R):5'- CAGAAGAGAGAAGAGACACCTTTC -3'
Posted On 2017-02-28