Incidental Mutation 'R5908:Sh3bp4'
ID 460758
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 044105-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5908 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 88998137-89082790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 89073605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 818 (S818A)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably damaging
Transcript: ENSMUST00000066279
AA Change: S818A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: S818A

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,624,730 (GRCm39) L198H probably damaging Het
Anks1 C T 17: 28,214,993 (GRCm39) T480I probably damaging Het
Arhgef18 G A 8: 3,503,165 (GRCm39) R857Q probably damaging Het
B230208B08Rik A G 4: 78,132,297 (GRCm39) noncoding transcript Het
B9d2 T A 7: 25,382,724 (GRCm39) W33R probably damaging Het
Bcl2a1c A G 9: 114,159,572 (GRCm39) T117A probably benign Het
Btbd8 T G 5: 107,655,460 (GRCm39) D574E probably damaging Het
Cabin1 A G 10: 75,557,366 (GRCm39) S1091P probably damaging Het
Clip3 C A 7: 29,996,298 (GRCm39) D64E probably damaging Het
Col6a5 C G 9: 105,740,000 (GRCm39) D2540H possibly damaging Het
Commd5 A T 15: 76,785,136 (GRCm39) M178L probably benign Het
Crtc3 T A 7: 80,245,542 (GRCm39) H361L possibly damaging Het
Dip2b T A 15: 100,049,065 (GRCm39) L153Q possibly damaging Het
Eif2s1 T A 12: 78,926,817 (GRCm39) V189D probably damaging Het
Etl4 C T 2: 20,748,718 (GRCm39) A483V probably damaging Het
Foxo3 T C 10: 42,072,583 (GRCm39) I645V probably benign Het
Gm4841 A G 18: 60,403,506 (GRCm39) S196P possibly damaging Het
Hip1 A G 5: 135,453,717 (GRCm39) probably null Het
Il36rn G T 2: 24,167,502 (GRCm39) probably benign Het
Ints2 A G 11: 86,106,371 (GRCm39) probably null Het
Khnyn A G 14: 56,124,523 (GRCm39) D259G probably benign Het
Lyst T A 13: 13,871,346 (GRCm39) Y2694* probably null Het
Map4k2 T C 19: 6,401,346 (GRCm39) probably benign Het
Marchf10 C T 11: 105,281,065 (GRCm39) V407I probably benign Het
Mast4 C A 13: 102,874,764 (GRCm39) V1367F probably damaging Het
Mrgprb3 A T 7: 48,293,366 (GRCm39) S62T probably damaging Het
Mthfd1l T C 10: 4,039,392 (GRCm39) F801S probably damaging Het
Nhsl3 A G 4: 129,115,941 (GRCm39) S908P probably damaging Het
Notch2 T C 3: 98,031,239 (GRCm39) probably benign Het
Nr2e1 T C 10: 42,448,765 (GRCm39) S158G probably benign Het
Nup214 A G 2: 31,881,353 (GRCm39) I404V probably benign Het
Or13n4 T C 7: 106,423,404 (GRCm39) T110A probably benign Het
Pik3c2g G A 6: 139,714,436 (GRCm39) R196H Het
Pik3r3 A T 4: 116,129,955 (GRCm39) D213V probably benign Het
Pip5k1b A T 19: 24,374,501 (GRCm39) S27T possibly damaging Het
Pkp1 G A 1: 135,846,621 (GRCm39) Q44* probably null Het
Pnma8b C T 7: 16,680,968 (GRCm39) R651C unknown Het
Pnpt1 T A 11: 29,080,887 (GRCm39) S44T probably benign Het
Polb A T 8: 23,132,319 (GRCm39) probably null Het
Pom121l2 A G 13: 22,165,984 (GRCm39) N85S probably damaging Het
Prim1 A G 10: 127,853,893 (GRCm39) K104E probably damaging Het
Prl8a1 T A 13: 27,758,040 (GRCm39) Y223F probably benign Het
Rbak T G 5: 143,159,391 (GRCm39) H554P probably damaging Het
Serpina3c T C 12: 104,117,970 (GRCm39) R123G probably benign Het
Sh3rf3 C G 10: 58,885,270 (GRCm39) H384Q probably benign Het
Slc9a8 C T 2: 167,293,090 (GRCm39) probably benign Het
Sptbn4 T C 7: 27,103,678 (GRCm39) E1181G probably benign Het
Taf2 G A 15: 54,935,402 (GRCm39) probably benign Het
Taf7l2 A T 10: 115,949,133 (GRCm39) I131N probably benign Het
Tbc1d9 A T 8: 83,976,174 (GRCm39) M578L probably benign Het
Tinagl1 G T 4: 130,066,763 (GRCm39) Y111* probably null Het
Tor2a T C 2: 32,651,697 (GRCm39) L304P probably damaging Het
Trp53bp1 A G 2: 121,067,304 (GRCm39) V474A probably benign Het
Trrap C A 5: 144,723,518 (GRCm39) A325E probably damaging Het
Ube4a A G 9: 44,859,322 (GRCm39) probably null Het
Use1 G C 8: 71,822,257 (GRCm39) K239N probably damaging Het
Vps9d1 G T 8: 123,973,563 (GRCm39) Q407K probably benign Het
Zfp36l1 A T 12: 80,156,449 (GRCm39) S311T possibly damaging Het
Zfp729b T C 13: 67,739,374 (GRCm39) K964E probably benign Het
Zfp974 T A 7: 27,610,382 (GRCm39) M448L probably benign Het
Zfyve28 A T 5: 34,374,214 (GRCm39) V600E possibly damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89,071,682 (GRCm39) missense probably benign
IGL01344:Sh3bp4 APN 1 89,080,958 (GRCm39) missense probably benign
IGL02025:Sh3bp4 APN 1 89,073,008 (GRCm39) missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89,071,412 (GRCm39) missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89,072,870 (GRCm39) missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89,080,885 (GRCm39) missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89,071,266 (GRCm39) splice site probably benign
IGL03327:Sh3bp4 APN 1 89,071,885 (GRCm39) nonsense probably null
I0000:Sh3bp4 UTSW 1 89,065,518 (GRCm39) missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89,073,156 (GRCm39) missense probably benign
R0128:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89,071,494 (GRCm39) missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89,073,210 (GRCm39) missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89,073,314 (GRCm39) missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89,073,050 (GRCm39) missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89,073,591 (GRCm39) missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89,071,995 (GRCm39) missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89,073,317 (GRCm39) missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89,071,962 (GRCm39) missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89,065,456 (GRCm39) missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89,071,997 (GRCm39) missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89,073,072 (GRCm39) missense probably benign
R6296:Sh3bp4 UTSW 1 89,073,211 (GRCm39) missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89,072,643 (GRCm39) missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89,080,888 (GRCm39) missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89,073,489 (GRCm39) missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89,080,824 (GRCm39) splice site probably null
R7320:Sh3bp4 UTSW 1 89,073,216 (GRCm39) missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89,072,170 (GRCm39) missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89,073,368 (GRCm39) missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89,073,037 (GRCm39) missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89,073,297 (GRCm39) missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89,080,064 (GRCm39) missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89,072,159 (GRCm39) missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89,072,647 (GRCm39) nonsense probably null
R9718:Sh3bp4 UTSW 1 89,073,472 (GRCm39) missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89,072,744 (GRCm39) missense probably benign
Z1176:Sh3bp4 UTSW 1 89,073,450 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACACCAAGAACGTGCTGGTC -3'
(R):5'- ACCATAGAGGATCGGAACTGTAAC -3'

Sequencing Primer
(F):5'- TGCGGACCTTACTCATGGAGAAC -3'
(R):5'- CAGAAGAGAGAAGAGACACCTTTC -3'
Posted On 2017-02-28