Incidental Mutation 'R5908:Pkp1'
ID460759
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
MMRRC Submission 044105-MU
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R5908 (G1)
Quality Score193
Status Validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 135918883 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 44 (Q44*)
Ref Sequence ENSEMBL: ENSMUSP00000140883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably null
Transcript: ENSMUST00000027667
AA Change: Q44*
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: Q44*

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163260
AA Change: Q44*
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: Q44*

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189805
AA Change: Q44*
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413
AA Change: Q44*

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCAAAGCGGGCTGACATTC -3'
(R):5'- ATATCCTGTCTGACGGAGGG -3'

Sequencing Primer
(F):5'- GGCTGACATTCAGTCCCC -3'
(R):5'- AGCGCTCTATGGCCAAAG -3'
Posted On2017-02-28