Incidental Mutation 'R0564:Gm4922'
ID 46076
Institutional Source Beutler Lab
Gene Symbol Gm4922
Ensembl Gene ENSMUSG00000044624
Gene Name predicted gene 4922
Synonyms
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 18655475-18662541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18659813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 303 (N303I)
Ref Sequence ENSEMBL: ENSMUSP00000149756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055107] [ENSMUST00000216654]
AlphaFold Q8C0N0
Predicted Effect possibly damaging
Transcript: ENSMUST00000055107
AA Change: N303I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055273
Gene: ENSMUSG00000044624
AA Change: N303I

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
S_TKc 28 275 1.92e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215162
Predicted Effect possibly damaging
Transcript: ENSMUST00000216654
AA Change: N303I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Gm4922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Gm4922 APN 10 18,659,795 (GRCm39) missense probably benign 0.20
IGL01818:Gm4922 APN 10 18,660,701 (GRCm39) missense unknown
IGL01931:Gm4922 APN 10 18,660,042 (GRCm39) missense probably benign 0.01
IGL02021:Gm4922 APN 10 18,660,225 (GRCm39) missense probably damaging 1.00
IGL02573:Gm4922 APN 10 18,659,423 (GRCm39) missense probably benign 0.05
IGL03305:Gm4922 APN 10 18,659,232 (GRCm39) nonsense probably null
R0149:Gm4922 UTSW 10 18,659,289 (GRCm39) missense probably benign 0.10
R0361:Gm4922 UTSW 10 18,659,289 (GRCm39) missense probably benign 0.10
R1079:Gm4922 UTSW 10 18,660,086 (GRCm39) missense probably damaging 0.97
R1163:Gm4922 UTSW 10 18,659,469 (GRCm39) missense possibly damaging 0.83
R1164:Gm4922 UTSW 10 18,659,469 (GRCm39) missense possibly damaging 0.83
R1398:Gm4922 UTSW 10 18,659,496 (GRCm39) missense possibly damaging 0.65
R1458:Gm4922 UTSW 10 18,659,640 (GRCm39) nonsense probably null
R1867:Gm4922 UTSW 10 18,660,211 (GRCm39) missense possibly damaging 0.73
R1994:Gm4922 UTSW 10 18,659,388 (GRCm39) missense probably benign 0.10
R2146:Gm4922 UTSW 10 18,659,264 (GRCm39) missense probably benign
R2437:Gm4922 UTSW 10 18,659,829 (GRCm39) missense probably benign 0.00
R3551:Gm4922 UTSW 10 18,660,244 (GRCm39) missense probably benign 0.01
R3939:Gm4922 UTSW 10 18,660,362 (GRCm39) missense probably damaging 1.00
R4580:Gm4922 UTSW 10 18,659,432 (GRCm39) missense probably benign 0.00
R4602:Gm4922 UTSW 10 18,660,007 (GRCm39) nonsense probably null
R4704:Gm4922 UTSW 10 18,660,567 (GRCm39) missense probably benign 0.20
R4790:Gm4922 UTSW 10 18,659,916 (GRCm39) missense possibly damaging 0.58
R5478:Gm4922 UTSW 10 18,659,885 (GRCm39) missense probably benign
R5510:Gm4922 UTSW 10 18,659,745 (GRCm39) missense probably benign 0.00
R5694:Gm4922 UTSW 10 18,660,035 (GRCm39) missense possibly damaging 0.76
R6080:Gm4922 UTSW 10 18,660,500 (GRCm39) missense probably damaging 1.00
R6869:Gm4922 UTSW 10 18,660,263 (GRCm39) missense probably damaging 1.00
R6923:Gm4922 UTSW 10 18,659,616 (GRCm39) missense probably damaging 1.00
R7667:Gm4922 UTSW 10 18,660,096 (GRCm39) missense probably damaging 1.00
R8198:Gm4922 UTSW 10 18,659,340 (GRCm39) missense probably benign 0.00
R8270:Gm4922 UTSW 10 18,659,760 (GRCm39) missense probably benign 0.00
R8310:Gm4922 UTSW 10 18,659,536 (GRCm39) missense probably benign 0.09
R9454:Gm4922 UTSW 10 18,660,329 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGTGCAAAAGCTGCTGTCTTC -3'
(R):5'- GCCTGTTATTGGCAACAAACGCAAG -3'

Sequencing Primer
(F):5'- TTAAAGGAAGGTTCACTGGCCC -3'
(R):5'- CAAGGCAGAGGCCAACTG -3'
Posted On 2013-06-11