Incidental Mutation 'R5908:B9d2'
ID460778
Institutional Source Beutler Lab
Gene Symbol B9d2
Ensembl Gene ENSMUSG00000063439
Gene NameB9 protein domain 2
Synonymsstumpy
MMRRC Submission 044105-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5908 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25680780-25686558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25683299 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 33 (W33R)
Ref Sequence ENSEMBL: ENSMUSP00000145729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002678] [ENSMUST00000108403] [ENSMUST00000205325] [ENSMUST00000205658] [ENSMUST00000206913]
Predicted Effect probably benign
Transcript: ENSMUST00000002678
SMART Domains Protein: ENSMUSP00000002678
Gene: ENSMUSG00000002603

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:TGFb_propeptide 29 261 3.2e-41 PFAM
TGFB 293 390 1.95e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108403
AA Change: W33R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104040
Gene: ENSMUSG00000063439
AA Change: W33R

DomainStartEndE-ValueType
Pfam:B9-C2 4 164 5.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205325
AA Change: W33R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205658
AA Change: W33R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206584
Predicted Effect probably benign
Transcript: ENSMUST00000206913
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B9 domain protein, which are exclusively found in ciliated organisms. The gene is upregulated during mucociliary differentiation, and the encoded protein localizes to basal bodies and cilia. Disrupting expression of this gene results in ciliogenesis defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice carrying a targeted mutation of this gene exhibit preweaning lethality, hydrops fetalis, and abnormalities in craniofacial, limb, and eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in B9d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03118:B9d2 APN 7 25681476 critical splice donor site probably null
R0607:B9d2 UTSW 7 25683332 missense probably damaging 1.00
R4281:B9d2 UTSW 7 25681426 missense possibly damaging 0.69
R5179:B9d2 UTSW 7 25681401 missense probably damaging 1.00
R5575:B9d2 UTSW 7 25683332 missense probably damaging 1.00
R6921:B9d2 UTSW 7 25686017 missense probably damaging 1.00
R7560:B9d2 UTSW 7 25681359 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCGTGCCAGGATTTCTACAC -3'
(R):5'- AAGCCCAGCTCCTCTTAGTTTG -3'

Sequencing Primer
(F):5'- CTTTGAAGTCACAGAGATCAGCCTG -3'
(R):5'- AGCTCCTCTTAGTTTGACTGC -3'
Posted On2017-02-28