Incidental Mutation 'R5908:March10'
ID460803
Institutional Source Beutler Lab
Gene Symbol March10
Ensembl Gene ENSMUSG00000078627
Gene Namemembrane-associated ring finger (C3HC4) 10
Synonyms4933417C16Rik, OTTMUSG00000002847, Rnf190
MMRRC Submission 044105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5908 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105360798-105456735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105390239 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 407 (V407I)
Ref Sequence ENSEMBL: ENSMUSP00000121919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049995] [ENSMUST00000138977]
Predicted Effect probably benign
Transcript: ENSMUST00000049995
AA Change: V407I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063198
Gene: ENSMUSG00000078627
AA Change: V407I

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138977
AA Change: V407I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121919
Gene: ENSMUSG00000078627
AA Change: V407I

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153672
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Abcc10 A T 17: 46,313,804 L198H probably damaging Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H probably damaging Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in March10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:March10 APN 11 105402188 missense possibly damaging 0.82
IGL01461:March10 APN 11 105389605 missense probably damaging 1.00
IGL01473:March10 APN 11 105389605 missense probably damaging 1.00
Forward UTSW 11 105382237 missense probably damaging 1.00
PIT4142001:March10 UTSW 11 105390520 missense probably benign 0.17
R0195:March10 UTSW 11 105385525 missense probably damaging 1.00
R0520:March10 UTSW 11 105389882 missense probably benign
R0628:March10 UTSW 11 105390160 missense probably benign 0.00
R1087:March10 UTSW 11 105390662 missense probably damaging 1.00
R1440:March10 UTSW 11 105390583 missense probably damaging 1.00
R1802:March10 UTSW 11 105389915 missense probably benign 0.00
R1855:March10 UTSW 11 105390392 missense probably benign
R1860:March10 UTSW 11 105397078 missense probably damaging 0.99
R2504:March10 UTSW 11 105385572 missense probably damaging 1.00
R3788:March10 UTSW 11 105397079 missense probably damaging 1.00
R4629:March10 UTSW 11 105389838 missense probably benign 0.28
R4755:March10 UTSW 11 105364476 intron probably benign
R4776:March10 UTSW 11 105390037 missense probably benign 0.42
R5067:March10 UTSW 11 105390107 missense possibly damaging 0.51
R5192:March10 UTSW 11 105371926 missense possibly damaging 0.68
R5436:March10 UTSW 11 105402165 missense possibly damaging 0.92
R5541:March10 UTSW 11 105390131 missense probably damaging 1.00
R5888:March10 UTSW 11 105402146 missense possibly damaging 0.92
R5914:March10 UTSW 11 105385482 missense probably damaging 1.00
R6038:March10 UTSW 11 105402051 missense probably damaging 0.96
R6178:March10 UTSW 11 105389614 missense probably damaging 1.00
R6300:March10 UTSW 11 105382237 missense probably damaging 1.00
R6612:March10 UTSW 11 105397078 missense probably damaging 0.99
R6894:March10 UTSW 11 105396961 missense possibly damaging 0.94
R6921:March10 UTSW 11 105389777 missense probably benign 0.00
R7134:March10 UTSW 11 105408676 missense probably benign
R7199:March10 UTSW 11 105390706 missense probably damaging 0.99
R7546:March10 UTSW 11 105390080 missense not run
R7792:March10 UTSW 11 105390228 missense probably benign
Z1088:March10 UTSW 11 105390359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGTCTATCAGAGCAGAATGG -3'
(R):5'- TAAGATGGAGTGAGCCCAGC -3'

Sequencing Primer
(F):5'- CAGTGACCCATGAGCACTGTAAG -3'
(R):5'- GCCCTGGATCTCCAAGAAAAAC -3'
Posted On2017-02-28