Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Mpp3'

46081

Institutional Source

Beutler Lab

Gene Symbol

Mpp3

Ensembl Gene

ENSMUSG00000052373

Gene Name

membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)

Synonyms

Dlgh3

MMRRC Submission

038755-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101999652-102028461 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 102005347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 450 (K450T)

Ref Sequence

ENSEMBL: ENSMUSP00000102786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062801
AA Change: K450T

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: K450T

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100400
AA Change: K450T

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: K450T

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107168
AA Change: K450T

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: K450T

Domain	Start	End	E-Value	Type
L27	10	64	1.5e-8	SMART
L27	68	121	1.18e-15	SMART
PDZ	145	218	1.06e-13	SMART
SH3	229	295	7.7e-9	SMART
GuKc	384	573	1.76e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127053

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132094

Meta Mutation Damage Score

0.2513

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Col6a3	A	C	1: 90,807,734	V731G	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Esf1	A	T	2: 140,158,586	Y427N	possibly damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sema3e	T	A	5: 14,236,085		probably null	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Trio	T	C	15: 27,805,822	N527D	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Mpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Mpp3	APN	11	102002103	missense	possibly damaging	0.76
IGL01337:Mpp3	APN	11	102000585	missense	probably benign
IGL01393:Mpp3	APN	11	102025478	missense	probably damaging	0.99
IGL01544:Mpp3	APN	11	102018659	missense	possibly damaging	0.91
IGL02152:Mpp3	APN	11	102025390	nonsense	probably null
IGL02441:Mpp3	APN	11	102009675	missense	probably benign	0.00
IGL02656:Mpp3	APN	11	102008601	missense	probably benign
R0013:Mpp3	UTSW	11	102005425	missense	probably benign	0.27
R0117:Mpp3	UTSW	11	102000573	missense	probably damaging	1.00
R1372:Mpp3	UTSW	11	102000575	missense	probably damaging	0.96
R1531:Mpp3	UTSW	11	102008649	missense	probably benign
R1639:Mpp3	UTSW	11	102023442	missense	probably damaging	1.00
R1720:Mpp3	UTSW	11	102025756	start codon destroyed	possibly damaging	0.79
R1968:Mpp3	UTSW	11	102018552	intron	probably benign
R2064:Mpp3	UTSW	11	102000690	missense	probably benign	0.01
R2363:Mpp3	UTSW	11	102020486	missense	probably damaging	1.00
R3775:Mpp3	UTSW	11	102023367	nonsense	probably null
R3776:Mpp3	UTSW	11	102023367	nonsense	probably null
R4208:Mpp3	UTSW	11	102000600	missense	probably benign
R4287:Mpp3	UTSW	11	102023463	missense	probably damaging	1.00
R4327:Mpp3	UTSW	11	102023511	intron	probably benign
R4329:Mpp3	UTSW	11	102023511	intron	probably benign
R4367:Mpp3	UTSW	11	102023420	missense	probably benign	0.01
R4856:Mpp3	UTSW	11	102025136	missense	probably benign
R4886:Mpp3	UTSW	11	102025136	missense	probably benign
R4904:Mpp3	UTSW	11	102000587	missense	probably benign	0.01
R4946:Mpp3	UTSW	11	102005022	missense	probably benign	0.01
R5405:Mpp3	UTSW	11	102010221	missense	probably benign
R5935:Mpp3	UTSW	11	102025415	missense	probably damaging	1.00
R6020:Mpp3	UTSW	11	102018539	intron	probably benign
R6056:Mpp3	UTSW	11	102011689	splice site	probably null
R6151:Mpp3	UTSW	11	102008566	missense	probably benign	0.11
R6677:Mpp3	UTSW	11	102008618	missense	probably benign
R6784:Mpp3	UTSW	11	102002148	critical splice acceptor site	probably null
R6855:Mpp3	UTSW	11	102013325	missense	probably benign	0.09
R7227:Mpp3	UTSW	11	102005078	missense	possibly damaging	0.90
R7635:Mpp3	UTSW	11	102025383	missense	probably damaging	0.97
R7974:Mpp3	UTSW	11	102008354	critical splice donor site	probably null
R8330:Mpp3	UTSW	11	102008627	missense	probably benign	0.20
R8331:Mpp3	UTSW	11	102011715	splice site	probably null
R8993:Mpp3	UTSW	11	102000665	missense	probably benign	0.03
R9154:Mpp3	UTSW	11	102020502	missense
R9593:Mpp3	UTSW	11	102016680	missense	possibly damaging	0.88
R9655:Mpp3	UTSW	11	102008655	missense	probably benign
Z1176:Mpp3	UTSW	11	102008356	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGGGAAGCCCCAACTTCACAAAGG -3'
(R):5'- TTGCTGGGGACACGCGATGAAATG -3'

Sequencing Primer
(F):5'- AAGGGGACATCCCAATATGAC -3'
(R):5'- CACGCGATGAAATGGAAGTTC -3'

Posted On

2013-06-11