Incidental Mutation 'R5908:Dip2b'
ID 460816
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 044105-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R5908 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100049065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 153 (L153Q)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100203
AA Change: L153Q

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: L153Q

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,624,730 (GRCm39) L198H probably damaging Het
Anks1 C T 17: 28,214,993 (GRCm39) T480I probably damaging Het
Arhgef18 G A 8: 3,503,165 (GRCm39) R857Q probably damaging Het
B230208B08Rik A G 4: 78,132,297 (GRCm39) noncoding transcript Het
B9d2 T A 7: 25,382,724 (GRCm39) W33R probably damaging Het
Bcl2a1c A G 9: 114,159,572 (GRCm39) T117A probably benign Het
Btbd8 T G 5: 107,655,460 (GRCm39) D574E probably damaging Het
Cabin1 A G 10: 75,557,366 (GRCm39) S1091P probably damaging Het
Clip3 C A 7: 29,996,298 (GRCm39) D64E probably damaging Het
Col6a5 C G 9: 105,740,000 (GRCm39) D2540H possibly damaging Het
Commd5 A T 15: 76,785,136 (GRCm39) M178L probably benign Het
Crtc3 T A 7: 80,245,542 (GRCm39) H361L possibly damaging Het
Eif2s1 T A 12: 78,926,817 (GRCm39) V189D probably damaging Het
Etl4 C T 2: 20,748,718 (GRCm39) A483V probably damaging Het
Foxo3 T C 10: 42,072,583 (GRCm39) I645V probably benign Het
Gm4841 A G 18: 60,403,506 (GRCm39) S196P possibly damaging Het
Hip1 A G 5: 135,453,717 (GRCm39) probably null Het
Il36rn G T 2: 24,167,502 (GRCm39) probably benign Het
Ints2 A G 11: 86,106,371 (GRCm39) probably null Het
Khnyn A G 14: 56,124,523 (GRCm39) D259G probably benign Het
Lyst T A 13: 13,871,346 (GRCm39) Y2694* probably null Het
Map4k2 T C 19: 6,401,346 (GRCm39) probably benign Het
Marchf10 C T 11: 105,281,065 (GRCm39) V407I probably benign Het
Mast4 C A 13: 102,874,764 (GRCm39) V1367F probably damaging Het
Mrgprb3 A T 7: 48,293,366 (GRCm39) S62T probably damaging Het
Mthfd1l T C 10: 4,039,392 (GRCm39) F801S probably damaging Het
Nhsl3 A G 4: 129,115,941 (GRCm39) S908P probably damaging Het
Notch2 T C 3: 98,031,239 (GRCm39) probably benign Het
Nr2e1 T C 10: 42,448,765 (GRCm39) S158G probably benign Het
Nup214 A G 2: 31,881,353 (GRCm39) I404V probably benign Het
Or13n4 T C 7: 106,423,404 (GRCm39) T110A probably benign Het
Pik3c2g G A 6: 139,714,436 (GRCm39) R196H Het
Pik3r3 A T 4: 116,129,955 (GRCm39) D213V probably benign Het
Pip5k1b A T 19: 24,374,501 (GRCm39) S27T possibly damaging Het
Pkp1 G A 1: 135,846,621 (GRCm39) Q44* probably null Het
Pnma8b C T 7: 16,680,968 (GRCm39) R651C unknown Het
Pnpt1 T A 11: 29,080,887 (GRCm39) S44T probably benign Het
Polb A T 8: 23,132,319 (GRCm39) probably null Het
Pom121l2 A G 13: 22,165,984 (GRCm39) N85S probably damaging Het
Prim1 A G 10: 127,853,893 (GRCm39) K104E probably damaging Het
Prl8a1 T A 13: 27,758,040 (GRCm39) Y223F probably benign Het
Rbak T G 5: 143,159,391 (GRCm39) H554P probably damaging Het
Serpina3c T C 12: 104,117,970 (GRCm39) R123G probably benign Het
Sh3bp4 T G 1: 89,073,605 (GRCm39) S818A probably damaging Het
Sh3rf3 C G 10: 58,885,270 (GRCm39) H384Q probably benign Het
Slc9a8 C T 2: 167,293,090 (GRCm39) probably benign Het
Sptbn4 T C 7: 27,103,678 (GRCm39) E1181G probably benign Het
Taf2 G A 15: 54,935,402 (GRCm39) probably benign Het
Taf7l2 A T 10: 115,949,133 (GRCm39) I131N probably benign Het
Tbc1d9 A T 8: 83,976,174 (GRCm39) M578L probably benign Het
Tinagl1 G T 4: 130,066,763 (GRCm39) Y111* probably null Het
Tor2a T C 2: 32,651,697 (GRCm39) L304P probably damaging Het
Trp53bp1 A G 2: 121,067,304 (GRCm39) V474A probably benign Het
Trrap C A 5: 144,723,518 (GRCm39) A325E probably damaging Het
Ube4a A G 9: 44,859,322 (GRCm39) probably null Het
Use1 G C 8: 71,822,257 (GRCm39) K239N probably damaging Het
Vps9d1 G T 8: 123,973,563 (GRCm39) Q407K probably benign Het
Zfp36l1 A T 12: 80,156,449 (GRCm39) S311T possibly damaging Het
Zfp729b T C 13: 67,739,374 (GRCm39) K964E probably benign Het
Zfp974 T A 7: 27,610,382 (GRCm39) M448L probably benign Het
Zfyve28 A T 5: 34,374,214 (GRCm39) V600E possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATACTTGGGAGATGTCACCAC -3'
(R):5'- CCAAGTGGAACATTGGGTGG -3'

Sequencing Primer
(F):5'- CTTGGGAGATGTCACCACTAATC -3'
(R):5'- CCTACCTATTCGAGTATTGGCAAAC -3'
Posted On 2017-02-28