Incidental Mutation 'R5908:Abcc10'
ID460818
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission 044105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5908 (G1)
Quality Score198
Status Validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46313804 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 198 (L198H)
Ref Sequence ENSEMBL: ENSMUSP00000132760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably damaging
Transcript: ENSMUST00000047970
AA Change: L749H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: L749H

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095261
AA Change: L708H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: L708H

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167360
AA Change: L749H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: L749H

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168490
AA Change: L198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842
AA Change: L198H

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,228 I131N probably benign Het
Anks1 C T 17: 27,996,019 T480I probably damaging Het
Arhgef18 G A 8: 3,453,165 R857Q probably damaging Het
B230208B08Rik A G 4: 78,214,060 noncoding transcript Het
B9d2 T A 7: 25,683,299 W33R probably damaging Het
Bcl2a1c A G 9: 114,330,504 T117A probably benign Het
Btbd8 T G 5: 107,507,594 D574E probably damaging Het
C77080 A G 4: 129,222,148 S908P probably damaging Het
Cabin1 A G 10: 75,721,532 S1091P probably damaging Het
Clip3 C A 7: 30,296,873 D64E probably damaging Het
Col6a5 C G 9: 105,862,801 D2540H possibly damaging Het
Commd5 A T 15: 76,900,936 M178L probably benign Het
Crtc3 T A 7: 80,595,794 H361L possibly damaging Het
Dip2b T A 15: 100,151,184 L153Q possibly damaging Het
Eif2s1 T A 12: 78,880,043 V189D probably damaging Het
Etl4 C T 2: 20,743,907 A483V probably damaging Het
Foxo3 T C 10: 42,196,587 I645V probably benign Het
Gm4841 A G 18: 60,270,434 S196P possibly damaging Het
Hip1 A G 5: 135,424,863 probably null Het
Il1f5 G T 2: 24,277,490 probably benign Het
Ints2 A G 11: 86,215,545 probably null Het
Khnyn A G 14: 55,887,066 D259G probably benign Het
Lyst T A 13: 13,696,761 Y2694* probably null Het
Map4k2 T C 19: 6,351,316 probably benign Het
March10 C T 11: 105,390,239 V407I probably benign Het
Mast4 C A 13: 102,738,256 V1367F probably damaging Het
Mrgprb3 A T 7: 48,643,618 S62T probably damaging Het
Mthfd1l T C 10: 4,089,392 F801S probably damaging Het
Notch2 T C 3: 98,123,923 probably benign Het
Nr2e1 T C 10: 42,572,769 S158G probably benign Het
Nup214 A G 2: 31,991,341 I404V probably benign Het
Olfr702 T C 7: 106,824,197 T110A probably benign Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pik3r3 A T 4: 116,272,758 D213V probably benign Het
Pip5k1b A T 19: 24,397,137 S27T possibly damaging Het
Pkp1 G A 1: 135,918,883 Q44* probably null Het
Pnmal2 C T 7: 16,947,043 R651C unknown Het
Pnpt1 T A 11: 29,130,887 S44T probably benign Het
Polb A T 8: 22,642,303 probably null Het
Pom121l2 A G 13: 21,981,814 N85S probably damaging Het
Prim1 A G 10: 128,018,024 K104E probably damaging Het
Prl8a1 T A 13: 27,574,057 Y223F probably benign Het
Rbak T G 5: 143,173,636 H554P probably damaging Het
Serpina3c T C 12: 104,151,711 R123G probably benign Het
Sh3bp4 T G 1: 89,145,883 S818A probably damaging Het
Sh3rf3 C G 10: 59,049,448 H384Q probably benign Het
Slc9a8 C T 2: 167,451,170 probably benign Het
Sptbn4 T C 7: 27,404,253 E1181G probably benign Het
Taf2 G A 15: 55,072,006 probably benign Het
Tbc1d9 A T 8: 83,249,545 M578L probably benign Het
Tinagl1 G T 4: 130,172,970 Y111* probably null Het
Tor2a T C 2: 32,761,685 L304P probably damaging Het
Trp53bp1 A G 2: 121,236,823 V474A probably benign Het
Trrap C A 5: 144,786,708 A325E probably damaging Het
Ube4a A G 9: 44,948,024 probably null Het
Use1 G C 8: 71,369,613 K239N probably damaging Het
Vps9d1 G T 8: 123,246,824 Q407K probably benign Het
Zfp36l1 A T 12: 80,109,675 S311T possibly damaging Het
Zfp729b T C 13: 67,591,255 K964E probably benign Het
Zfp974 T A 7: 27,910,957 M448L probably benign Het
Zfyve28 A T 5: 34,216,870 V600E possibly damaging Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 splice site probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
Decrepit UTSW 17 46324391 missense probably damaging 1.00
Shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
R7584:Abcc10 UTSW 17 46315378 splice site probably null
R7862:Abcc10 UTSW 17 46315532 nonsense probably null
R7883:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7896:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7897:Abcc10 UTSW 17 46324073 missense probably benign 0.00
R8316:Abcc10 UTSW 17 46327809 missense probably damaging 0.99
R8354:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
R8414:Abcc10 UTSW 17 46312347 missense probably benign 0.28
R8454:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Z1176:Abcc10 UTSW 17 46313700 missense probably damaging 0.97
Z1176:Abcc10 UTSW 17 46324262 missense probably benign 0.00
Z1177:Abcc10 UTSW 17 46307062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACCAGGCCAAGTGTTTG -3'
(R):5'- ACGTCTCTGGTTTCACACTCAG -3'

Sequencing Primer
(F):5'- ATACCAGGCCAAGTGTTTGTTCTAC -3'
(R):5'- CACTCAGTGGAGAGGAAGTACCC -3'
Posted On2017-02-28