Incidental Mutation 'R5909:Sulf1'
ID460821
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 044106-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R5909 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12858815 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 102 (D102V)
Ref Sequence ENSEMBL: ENSMUSP00000140517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000185780]
Predicted Effect silent
Transcript: ENSMUST00000088585
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000177608
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000180062
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185780
AA Change: D102V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T C 9: 30,961,928 S810P probably benign Het
Adcy7 A T 8: 88,325,496 I931F probably damaging Het
Alcam G T 16: 52,290,993 Q248K probably benign Het
Astn1 A C 1: 158,601,937 R750S probably damaging Het
Atp1a2 A T 1: 172,287,230 N329K probably damaging Het
Bcl6 A G 16: 23,972,806 V266A probably benign Het
Bdp1 A G 13: 100,092,286 V278A probably benign Het
Ccdc162 T C 10: 41,561,115 E493G probably damaging Het
Cpvl T C 6: 53,932,428 Y241C probably damaging Het
Ddx55 T C 5: 124,566,850 M390T probably benign Het
Ero1lb A G 13: 12,579,258 E102G probably benign Het
Etnk1 A G 6: 143,197,438 D273G probably benign Het
Exoc3 A G 13: 74,199,524 V109A probably damaging Het
F830016B08Rik T A 18: 60,300,019 I58N probably damaging Het
Fancd2 T A 6: 113,561,711 V589E probably benign Het
Fbll1 G A 11: 35,798,332 R35C unknown Het
Fnbp1 A G 2: 31,048,199 probably null Het
Glce G T 9: 62,060,144 A575D probably damaging Het
Gm14548 G A 7: 3,897,622 T43I probably damaging Het
Ift20 T A 11: 78,540,041 M70K possibly damaging Het
Impg2 T C 16: 56,258,136 V487A probably damaging Het
Isx A G 8: 74,892,798 D206G probably benign Het
Jak3 A G 8: 71,684,231 I684V possibly damaging Het
Kdm5d G A Y: 941,306 S1169N probably benign Het
Krt35 A T 11: 100,095,813 L125Q probably damaging Het
Lama4 G A 10: 39,072,859 A873T probably benign Het
Lrch4 T C 5: 137,633,865 S74P possibly damaging Het
Maneal A T 4: 124,857,173 Y263* probably null Het
Mcat C T 15: 83,547,915 A251T probably benign Het
Mup3 T G 4: 62,086,007 T90P probably benign Het
Mybpc2 G A 7: 44,507,091 A812V probably damaging Het
Naa15 T C 3: 51,460,064 F503L probably damaging Het
Nudt8 T C 19: 4,000,727 L25S possibly damaging Het
Oas1e A T 5: 120,788,907 V245D probably damaging Het
Ofcc1 A G 13: 40,263,578 M109T possibly damaging Het
Olfr1179 A T 2: 88,402,191 F248I probably damaging Het
Olfr48 A G 2: 89,844,391 V194A possibly damaging Het
Phkb G T 8: 86,021,447 probably null Het
Pidd1 A C 7: 141,441,270 L365R probably damaging Het
Pkd1l2 G A 8: 117,024,056 R1739C probably benign Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkhd1l1 G T 15: 44,526,763 W1425L probably damaging Het
Plxna4 A G 6: 32,517,246 L145P probably damaging Het
Plxnd1 G T 6: 115,968,688 D941E probably benign Het
Prdm13 G T 4: 21,683,894 Q126K unknown Het
Rbm25 T A 12: 83,681,588 V837E probably damaging Het
Rcc2 T A 4: 140,717,068 Y357N probably damaging Het
Siglec1 A T 2: 131,077,964 N882K probably damaging Het
Sox13 A G 1: 133,383,889 I535T probably benign Het
Srrm2 T C 17: 23,821,317 S2408P probably benign Het
Stat3 G A 11: 100,903,730 T251I probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem145 G T 7: 25,308,193 L208F possibly damaging Het
Trim17 A T 11: 58,968,680 E240V probably damaging Het
Trim43b A T 9: 89,085,398 I395K possibly damaging Het
Trmt61a C A 12: 111,680,858 H130N probably damaging Het
Unc5b A C 10: 60,772,359 L654R probably damaging Het
Vmn1r66 A T 7: 10,274,342 S255T probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb10 T C 3: 9,280,049 F677S probably benign Het
Zfp493 T A 13: 67,786,598 C223* probably null Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 utr 3 prime probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAACAGTGCCACTCCTGTTTC -3'
(R):5'- CAAAGGCTCTGTAGACAGCC -3'

Sequencing Primer
(F):5'- CTCAATCCACTGAGTGTGTAGCAG -3'
(R):5'- TAGACAGCCCTCAGGTAGTTAGTC -3'
Posted On2017-02-28