Incidental Mutation 'R5909:Fnbp1'
ID460824
Institutional Source Beutler Lab
Gene Symbol Fnbp1
Ensembl Gene ENSMUSG00000075415
Gene Nameformin binding protein 1
Synonyms2210010H06Rik, FBP17, FBP1, 1110057E06Rik
MMRRC Submission 044106-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R5909 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31026206-31142008 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 31048199 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000073879] [ENSMUST00000075326] [ENSMUST00000100207] [ENSMUST00000100208] [ENSMUST00000113555] [ENSMUST00000113559] [ENSMUST00000113560] [ENSMUST00000113562] [ENSMUST00000113564]
Predicted Effect probably benign
Transcript: ENSMUST00000073879
SMART Domains Protein: ENSMUSP00000109188
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075326
SMART Domains Protein: ENSMUSP00000074796
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 360 451 1e-26 PDB
low complexity region 503 512 N/A INTRINSIC
SH3 518 575 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100207
SMART Domains Protein: ENSMUSP00000097781
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 338 424 1e-26 PDB
low complexity region 476 485 N/A INTRINSIC
SH3 491 548 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100208
SMART Domains Protein: ENSMUSP00000097782
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 394 480 2e-26 PDB
low complexity region 532 541 N/A INTRINSIC
SH3 547 604 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113555
SMART Domains Protein: ENSMUSP00000109184
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 370 456 1e-26 PDB
low complexity region 508 517 N/A INTRINSIC
SH3 523 580 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113559
SMART Domains Protein: ENSMUSP00000109189
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
PDB:2EFL|A 1 221 1e-144 PDB
low complexity region 250 262 N/A INTRINSIC
PDB:2KE4|A 300 391 1e-26 PDB
low complexity region 443 452 N/A INTRINSIC
SH3 458 515 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113560
SMART Domains Protein: ENSMUSP00000109190
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
PDB:2KE4|A 399 485 2e-26 PDB
low complexity region 537 546 N/A INTRINSIC
SH3 552 609 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113562
SMART Domains Protein: ENSMUSP00000109192
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 471 480 N/A INTRINSIC
SH3 486 543 3.2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113564
SMART Domains Protein: ENSMUSP00000109194
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
FCH 1 94 4.11e-21 SMART
low complexity region 172 181 N/A INTRINSIC
PDB:2KE4|A 333 419 1e-26 PDB
low complexity region 472 481 N/A INTRINSIC
SH3 487 544 3.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128431
Predicted Effect probably benign
Transcript: ENSMUST00000128500
SMART Domains Protein: ENSMUSP00000115013
Gene: ENSMUSG00000075415

DomainStartEndE-ValueType
Pfam:FCH 1 80 7.7e-20 PFAM
PDB:2KE4|A 167 253 2e-27 PDB
low complexity region 305 314 N/A INTRINSIC
SH3 320 377 3.2e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138581
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the formin-binding-protein family. The protein contains an N-terminal Fer/Cdc42-interacting protein 4 (CIP4) homology (FCH) domain followed by a coiled-coil domain, a proline-rich motif, a second coiled-coil domain, a Rho family protein-binding domain (RBD), and a C-terminal SH3 domain. This protein binds sorting nexin 2 (SNX2), tankyrase (TNKS), and dynamin; an interaction between this protein and formin has not been demonstrated yet in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T C 9: 30,961,928 S810P probably benign Het
Adcy7 A T 8: 88,325,496 I931F probably damaging Het
Alcam G T 16: 52,290,993 Q248K probably benign Het
Astn1 A C 1: 158,601,937 R750S probably damaging Het
Atp1a2 A T 1: 172,287,230 N329K probably damaging Het
Bcl6 A G 16: 23,972,806 V266A probably benign Het
Bdp1 A G 13: 100,092,286 V278A probably benign Het
Ccdc162 T C 10: 41,561,115 E493G probably damaging Het
Cpvl T C 6: 53,932,428 Y241C probably damaging Het
Ddx55 T C 5: 124,566,850 M390T probably benign Het
Ero1lb A G 13: 12,579,258 E102G probably benign Het
Etnk1 A G 6: 143,197,438 D273G probably benign Het
Exoc3 A G 13: 74,199,524 V109A probably damaging Het
F830016B08Rik T A 18: 60,300,019 I58N probably damaging Het
Fancd2 T A 6: 113,561,711 V589E probably benign Het
Fbll1 G A 11: 35,798,332 R35C unknown Het
Glce G T 9: 62,060,144 A575D probably damaging Het
Gm14548 G A 7: 3,897,622 T43I probably damaging Het
Ift20 T A 11: 78,540,041 M70K possibly damaging Het
Impg2 T C 16: 56,258,136 V487A probably damaging Het
Isx A G 8: 74,892,798 D206G probably benign Het
Jak3 A G 8: 71,684,231 I684V possibly damaging Het
Kdm5d G A Y: 941,306 S1169N probably benign Het
Krt35 A T 11: 100,095,813 L125Q probably damaging Het
Lama4 G A 10: 39,072,859 A873T probably benign Het
Lrch4 T C 5: 137,633,865 S74P possibly damaging Het
Maneal A T 4: 124,857,173 Y263* probably null Het
Mcat C T 15: 83,547,915 A251T probably benign Het
Mup3 T G 4: 62,086,007 T90P probably benign Het
Mybpc2 G A 7: 44,507,091 A812V probably damaging Het
Naa15 T C 3: 51,460,064 F503L probably damaging Het
Nudt8 T C 19: 4,000,727 L25S possibly damaging Het
Oas1e A T 5: 120,788,907 V245D probably damaging Het
Ofcc1 A G 13: 40,263,578 M109T possibly damaging Het
Olfr1179 A T 2: 88,402,191 F248I probably damaging Het
Olfr48 A G 2: 89,844,391 V194A possibly damaging Het
Phkb G T 8: 86,021,447 probably null Het
Pidd1 A C 7: 141,441,270 L365R probably damaging Het
Pkd1l2 G A 8: 117,024,056 R1739C probably benign Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkhd1l1 G T 15: 44,526,763 W1425L probably damaging Het
Plxna4 A G 6: 32,517,246 L145P probably damaging Het
Plxnd1 G T 6: 115,968,688 D941E probably benign Het
Prdm13 G T 4: 21,683,894 Q126K unknown Het
Rbm25 T A 12: 83,681,588 V837E probably damaging Het
Rcc2 T A 4: 140,717,068 Y357N probably damaging Het
Siglec1 A T 2: 131,077,964 N882K probably damaging Het
Sox13 A G 1: 133,383,889 I535T probably benign Het
Srrm2 T C 17: 23,821,317 S2408P probably benign Het
Stat3 G A 11: 100,903,730 T251I probably benign Het
Sulf1 A T 1: 12,858,815 D102V possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem145 G T 7: 25,308,193 L208F possibly damaging Het
Trim17 A T 11: 58,968,680 E240V probably damaging Het
Trim43b A T 9: 89,085,398 I395K possibly damaging Het
Trmt61a C A 12: 111,680,858 H130N probably damaging Het
Unc5b A C 10: 60,772,359 L654R probably damaging Het
Vmn1r66 A T 7: 10,274,342 S255T probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb10 T C 3: 9,280,049 F677S probably benign Het
Zfp493 T A 13: 67,786,598 C223* probably null Het
Other mutations in Fnbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Fnbp1 APN 2 31083042 missense probably damaging 1.00
IGL01640:Fnbp1 APN 2 31105291 missense probably damaging 1.00
R0381:Fnbp1 UTSW 2 31033029 missense probably benign 0.02
R0573:Fnbp1 UTSW 2 31058978 missense probably damaging 1.00
R0713:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1120:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
R1364:Fnbp1 UTSW 2 31059031 splice site probably benign
R1974:Fnbp1 UTSW 2 31053047 missense probably null 0.94
R3800:Fnbp1 UTSW 2 31033131 missense probably damaging 1.00
R4176:Fnbp1 UTSW 2 31036119 splice site probably null
R4293:Fnbp1 UTSW 2 31105350 missense probably damaging 1.00
R4478:Fnbp1 UTSW 2 31105254 missense probably damaging 1.00
R4602:Fnbp1 UTSW 2 31036540 critical splice donor site probably null
R4716:Fnbp1 UTSW 2 31055520 missense probably benign 0.03
R6436:Fnbp1 UTSW 2 31096127 missense probably damaging 1.00
R7075:Fnbp1 UTSW 2 31058914 missense probably benign
R7747:Fnbp1 UTSW 2 31036147 missense probably damaging 0.99
R8069:Fnbp1 UTSW 2 31036594 missense probably damaging 0.97
Z1177:Fnbp1 UTSW 2 31083059 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAGAGGGCTTGGATCTTCC -3'
(R):5'- AGCCATCATAGTAGAGCAAGAC -3'

Sequencing Primer
(F):5'- AGAGGGCTTGGATCTTCCTATACAG -3'
(R):5'- CATTTTAGATGTCCATTGTTGCATG -3'
Posted On2017-02-28