Mutagenetix > Incidental Mutation

Incidental Mutation 'R5909:Plxnd1'

460843

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

044106-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 115968688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 941 (D941E)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: D941E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: D941E

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000131590
AA Change: D83E

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123
AA Change: D83E

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts8	T	C	9: 30,961,928	S810P	probably benign	Het
Adcy7	A	T	8: 88,325,496	I931F	probably damaging	Het
Alcam	G	T	16: 52,290,993	Q248K	probably benign	Het
Astn1	A	C	1: 158,601,937	R750S	probably damaging	Het
Atp1a2	A	T	1: 172,287,230	N329K	probably damaging	Het
Bcl6	A	G	16: 23,972,806	V266A	probably benign	Het
Bdp1	A	G	13: 100,092,286	V278A	probably benign	Het
Ccdc162	T	C	10: 41,561,115	E493G	probably damaging	Het
Cpvl	T	C	6: 53,932,428	Y241C	probably damaging	Het
Ddx55	T	C	5: 124,566,850	M390T	probably benign	Het
Ero1lb	A	G	13: 12,579,258	E102G	probably benign	Het
Etnk1	A	G	6: 143,197,438	D273G	probably benign	Het
Exoc3	A	G	13: 74,199,524	V109A	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,019	I58N	probably damaging	Het
Fancd2	T	A	6: 113,561,711	V589E	probably benign	Het
Fbll1	G	A	11: 35,798,332	R35C	unknown	Het
Fnbp1	A	G	2: 31,048,199		probably null	Het
Glce	G	T	9: 62,060,144	A575D	probably damaging	Het
Gm14548	G	A	7: 3,897,622	T43I	probably damaging	Het
Ift20	T	A	11: 78,540,041	M70K	possibly damaging	Het
Impg2	T	C	16: 56,258,136	V487A	probably damaging	Het
Isx	A	G	8: 74,892,798	D206G	probably benign	Het
Jak3	A	G	8: 71,684,231	I684V	possibly damaging	Het
Kdm5d	G	A	Y: 941,306	S1169N	probably benign	Het
Krt35	A	T	11: 100,095,813	L125Q	probably damaging	Het
Lama4	G	A	10: 39,072,859	A873T	probably benign	Het
Lrch4	T	C	5: 137,633,865	S74P	possibly damaging	Het
Maneal	A	T	4: 124,857,173	Y263*	probably null	Het
Mcat	C	T	15: 83,547,915	A251T	probably benign	Het
Mup3	T	G	4: 62,086,007	T90P	probably benign	Het
Mybpc2	G	A	7: 44,507,091	A812V	probably damaging	Het
Naa15	T	C	3: 51,460,064	F503L	probably damaging	Het
Nudt8	T	C	19: 4,000,727	L25S	possibly damaging	Het
Oas1e	A	T	5: 120,788,907	V245D	probably damaging	Het
Ofcc1	A	G	13: 40,263,578	M109T	possibly damaging	Het
Olfr1179	A	T	2: 88,402,191	F248I	probably damaging	Het
Olfr48	A	G	2: 89,844,391	V194A	possibly damaging	Het
Phkb	G	T	8: 86,021,447		probably null	Het
Pidd1	A	C	7: 141,441,270	L365R	probably damaging	Het
Pkd1l2	G	A	8: 117,024,056	R1739C	probably benign	Het
Pkdrej	A	T	15: 85,818,296	D1146E	possibly damaging	Het
Pkhd1l1	G	T	15: 44,526,763	W1425L	probably damaging	Het
Plxna4	A	G	6: 32,517,246	L145P	probably damaging	Het
Prdm13	G	T	4: 21,683,894	Q126K	unknown	Het
Rbm25	T	A	12: 83,681,588	V837E	probably damaging	Het
Rcc2	T	A	4: 140,717,068	Y357N	probably damaging	Het
Siglec1	A	T	2: 131,077,964	N882K	probably damaging	Het
Sox13	A	G	1: 133,383,889	I535T	probably benign	Het
Srrm2	T	C	17: 23,821,317	S2408P	probably benign	Het
Stat3	G	A	11: 100,903,730	T251I	probably benign	Het
Sulf1	A	T	1: 12,858,815	D102V	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmem145	G	T	7: 25,308,193	L208F	possibly damaging	Het
Trim17	A	T	11: 58,968,680	E240V	probably damaging	Het
Trim43b	A	T	9: 89,085,398	I395K	possibly damaging	Het
Trmt61a	C	A	12: 111,680,858	H130N	probably damaging	Het
Unc5b	A	C	10: 60,772,359	L654R	probably damaging	Het
Vmn1r66	A	T	7: 10,274,342	S255T	probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zbtb10	T	C	3: 9,280,049	F677S	probably benign	Het
Zfp493	T	A	13: 67,786,598	C223*	probably null	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTGGTTCTCATCAAAGCTCTGC -3'
(R):5'- TGGGCACACATGACAGTGAG -3'

Sequencing Primer
(F):5'- GCTTATGTGGCAGGAGGC -3'
(R):5'- TGAGAGAGACACCCAGGCCTC -3'

Posted On

2017-02-28