Incidental Mutation 'R5909:Pidd1'
ID460849
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Namep53 induced death domain protein 1
Synonyms1200011D09Rik, Lrdd, Pidd
MMRRC Submission 044106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5909 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141438113-141444025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 141441270 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 365 (L365R)
Ref Sequence ENSEMBL: ENSMUSP00000101627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000190882] [ENSMUST00000190068] [ENSMUST00000201822] [ENSMUST00000201710] [ENSMUST00000172654]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026580
AA Change: L365R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: L365R

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106005
AA Change: L365R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: L365R

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000128703
AA Change: S346A
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507
AA Change: S346A

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190303
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T C 9: 30,961,928 S810P probably benign Het
Adcy7 A T 8: 88,325,496 I931F probably damaging Het
Alcam G T 16: 52,290,993 Q248K probably benign Het
Astn1 A C 1: 158,601,937 R750S probably damaging Het
Atp1a2 A T 1: 172,287,230 N329K probably damaging Het
Bcl6 A G 16: 23,972,806 V266A probably benign Het
Bdp1 A G 13: 100,092,286 V278A probably benign Het
Ccdc162 T C 10: 41,561,115 E493G probably damaging Het
Cpvl T C 6: 53,932,428 Y241C probably damaging Het
Ddx55 T C 5: 124,566,850 M390T probably benign Het
Ero1lb A G 13: 12,579,258 E102G probably benign Het
Etnk1 A G 6: 143,197,438 D273G probably benign Het
Exoc3 A G 13: 74,199,524 V109A probably damaging Het
F830016B08Rik T A 18: 60,300,019 I58N probably damaging Het
Fancd2 T A 6: 113,561,711 V589E probably benign Het
Fbll1 G A 11: 35,798,332 R35C unknown Het
Fnbp1 A G 2: 31,048,199 probably null Het
Glce G T 9: 62,060,144 A575D probably damaging Het
Gm14548 G A 7: 3,897,622 T43I probably damaging Het
Ift20 T A 11: 78,540,041 M70K possibly damaging Het
Impg2 T C 16: 56,258,136 V487A probably damaging Het
Isx A G 8: 74,892,798 D206G probably benign Het
Jak3 A G 8: 71,684,231 I684V possibly damaging Het
Kdm5d G A Y: 941,306 S1169N probably benign Het
Krt35 A T 11: 100,095,813 L125Q probably damaging Het
Lama4 G A 10: 39,072,859 A873T probably benign Het
Lrch4 T C 5: 137,633,865 S74P possibly damaging Het
Maneal A T 4: 124,857,173 Y263* probably null Het
Mcat C T 15: 83,547,915 A251T probably benign Het
Mup3 T G 4: 62,086,007 T90P probably benign Het
Mybpc2 G A 7: 44,507,091 A812V probably damaging Het
Naa15 T C 3: 51,460,064 F503L probably damaging Het
Nudt8 T C 19: 4,000,727 L25S possibly damaging Het
Oas1e A T 5: 120,788,907 V245D probably damaging Het
Ofcc1 A G 13: 40,263,578 M109T possibly damaging Het
Olfr1179 A T 2: 88,402,191 F248I probably damaging Het
Olfr48 A G 2: 89,844,391 V194A possibly damaging Het
Phkb G T 8: 86,021,447 probably null Het
Pkd1l2 G A 8: 117,024,056 R1739C probably benign Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkhd1l1 G T 15: 44,526,763 W1425L probably damaging Het
Plxna4 A G 6: 32,517,246 L145P probably damaging Het
Plxnd1 G T 6: 115,968,688 D941E probably benign Het
Prdm13 G T 4: 21,683,894 Q126K unknown Het
Rbm25 T A 12: 83,681,588 V837E probably damaging Het
Rcc2 T A 4: 140,717,068 Y357N probably damaging Het
Siglec1 A T 2: 131,077,964 N882K probably damaging Het
Sox13 A G 1: 133,383,889 I535T probably benign Het
Srrm2 T C 17: 23,821,317 S2408P probably benign Het
Stat3 G A 11: 100,903,730 T251I probably benign Het
Sulf1 A T 1: 12,858,815 D102V possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem145 G T 7: 25,308,193 L208F possibly damaging Het
Trim17 A T 11: 58,968,680 E240V probably damaging Het
Trim43b A T 9: 89,085,398 I395K possibly damaging Het
Trmt61a C A 12: 111,680,858 H130N probably damaging Het
Unc5b A C 10: 60,772,359 L654R probably damaging Het
Vmn1r66 A T 7: 10,274,342 S255T probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb10 T C 3: 9,280,049 F677S probably benign Het
Zfp493 T A 13: 67,786,598 C223* probably null Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141439163 missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141443108 missense probably benign 0.00
IGL03083:Pidd1 APN 7 141440456 critical splice donor site probably null
IGL03347:Pidd1 APN 7 141439168 missense probably damaging 0.97
R0329:Pidd1 UTSW 7 141439561 unclassified probably benign
R0426:Pidd1 UTSW 7 141439133 missense probably damaging 1.00
R0650:Pidd1 UTSW 7 141440813 nonsense probably null
R0651:Pidd1 UTSW 7 141440813 nonsense probably null
R1201:Pidd1 UTSW 7 141440274 missense probably benign
R1221:Pidd1 UTSW 7 141438812 missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141440777 missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141439630 missense probably benign
R3967:Pidd1 UTSW 7 141439082 missense possibly damaging 0.86
R4072:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4073:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4075:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141441366 missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141441443 unclassified probably benign
R4700:Pidd1 UTSW 7 141442249 missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141442986 missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141438591 makesense probably null
R5402:Pidd1 UTSW 7 141438594 missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141441111 splice site probably null
R5790:Pidd1 UTSW 7 141441392 unclassified probably benign
R6275:Pidd1 UTSW 7 141439795 missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141439581 missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6872:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6935:Pidd1 UTSW 7 141440302 missense probably damaging 1.00
R7088:Pidd1 UTSW 7 141440487 missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141439900 missense probably benign 0.05
R7544:Pidd1 UTSW 7 141440339 missense possibly damaging 0.81
R7821:Pidd1 UTSW 7 141442280 missense probably benign 0.36
R7861:Pidd1 UTSW 7 141440142 missense probably damaging 1.00
R7903:Pidd1 UTSW 7 141439831 missense probably damaging 0.99
R8218:Pidd1 UTSW 7 141439653 missense probably damaging 1.00
Z1176:Pidd1 UTSW 7 141440361 missense probably benign 0.03
Z1177:Pidd1 UTSW 7 141438696 missense probably damaging 1.00
Z1177:Pidd1 UTSW 7 141441016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCACATCCTGTAGGCC -3'
(R):5'- TGCTGACCTCAGATTTGGAC -3'

Sequencing Primer
(F):5'- ATCCTGTAGGCCACAATAGTG -3'
(R):5'- TGTGGCTAGAACACATCGTC -3'
Posted On2017-02-28