Incidental Mutation 'R5909:Rbm25'
ID460868
Institutional Source Beutler Lab
Gene Symbol Rbm25
Ensembl Gene ENSMUSG00000010608
Gene NameRNA binding motif protein 25
SynonymsA130095G20Rik, 2610015J01Rik, 2600011C06Rik
MMRRC Submission 044106-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5909 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83631236-83683123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83681588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 837 (V837E)
Ref Sequence ENSEMBL: ENSMUSP00000048470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048155] [ENSMUST00000182450]
Predicted Effect probably damaging
Transcript: ENSMUST00000048155
AA Change: V837E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048470
Gene: ENSMUSG00000010608
AA Change: V837E

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
RRM 88 160 2.52e-11 SMART
low complexity region 234 241 N/A INTRINSIC
coiled coil region 270 351 N/A INTRINSIC
coiled coil region 382 549 N/A INTRINSIC
low complexity region 556 606 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
PWI 758 831 2.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182450
SMART Domains Protein: ENSMUSP00000138416
Gene: ENSMUSG00000010608

DomainStartEndE-ValueType
low complexity region 10 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 T C 9: 30,961,928 S810P probably benign Het
Adcy7 A T 8: 88,325,496 I931F probably damaging Het
Alcam G T 16: 52,290,993 Q248K probably benign Het
Astn1 A C 1: 158,601,937 R750S probably damaging Het
Atp1a2 A T 1: 172,287,230 N329K probably damaging Het
Bcl6 A G 16: 23,972,806 V266A probably benign Het
Bdp1 A G 13: 100,092,286 V278A probably benign Het
Ccdc162 T C 10: 41,561,115 E493G probably damaging Het
Cpvl T C 6: 53,932,428 Y241C probably damaging Het
Ddx55 T C 5: 124,566,850 M390T probably benign Het
Ero1lb A G 13: 12,579,258 E102G probably benign Het
Etnk1 A G 6: 143,197,438 D273G probably benign Het
Exoc3 A G 13: 74,199,524 V109A probably damaging Het
F830016B08Rik T A 18: 60,300,019 I58N probably damaging Het
Fancd2 T A 6: 113,561,711 V589E probably benign Het
Fbll1 G A 11: 35,798,332 R35C unknown Het
Fnbp1 A G 2: 31,048,199 probably null Het
Glce G T 9: 62,060,144 A575D probably damaging Het
Gm14548 G A 7: 3,897,622 T43I probably damaging Het
Ift20 T A 11: 78,540,041 M70K possibly damaging Het
Impg2 T C 16: 56,258,136 V487A probably damaging Het
Isx A G 8: 74,892,798 D206G probably benign Het
Jak3 A G 8: 71,684,231 I684V possibly damaging Het
Kdm5d G A Y: 941,306 S1169N probably benign Het
Krt35 A T 11: 100,095,813 L125Q probably damaging Het
Lama4 G A 10: 39,072,859 A873T probably benign Het
Lrch4 T C 5: 137,633,865 S74P possibly damaging Het
Maneal A T 4: 124,857,173 Y263* probably null Het
Mcat C T 15: 83,547,915 A251T probably benign Het
Mup3 T G 4: 62,086,007 T90P probably benign Het
Mybpc2 G A 7: 44,507,091 A812V probably damaging Het
Naa15 T C 3: 51,460,064 F503L probably damaging Het
Nudt8 T C 19: 4,000,727 L25S possibly damaging Het
Oas1e A T 5: 120,788,907 V245D probably damaging Het
Ofcc1 A G 13: 40,263,578 M109T possibly damaging Het
Olfr1179 A T 2: 88,402,191 F248I probably damaging Het
Olfr48 A G 2: 89,844,391 V194A possibly damaging Het
Phkb G T 8: 86,021,447 probably null Het
Pidd1 A C 7: 141,441,270 L365R probably damaging Het
Pkd1l2 G A 8: 117,024,056 R1739C probably benign Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkhd1l1 G T 15: 44,526,763 W1425L probably damaging Het
Plxna4 A G 6: 32,517,246 L145P probably damaging Het
Plxnd1 G T 6: 115,968,688 D941E probably benign Het
Prdm13 G T 4: 21,683,894 Q126K unknown Het
Rcc2 T A 4: 140,717,068 Y357N probably damaging Het
Siglec1 A T 2: 131,077,964 N882K probably damaging Het
Sox13 A G 1: 133,383,889 I535T probably benign Het
Srrm2 T C 17: 23,821,317 S2408P probably benign Het
Stat3 G A 11: 100,903,730 T251I probably benign Het
Sulf1 A T 1: 12,858,815 D102V possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem145 G T 7: 25,308,193 L208F possibly damaging Het
Trim17 A T 11: 58,968,680 E240V probably damaging Het
Trim43b A T 9: 89,085,398 I395K possibly damaging Het
Trmt61a C A 12: 111,680,858 H130N probably damaging Het
Unc5b A C 10: 60,772,359 L654R probably damaging Het
Vmn1r66 A T 7: 10,274,342 S255T probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb10 T C 3: 9,280,049 F677S probably benign Het
Zfp493 T A 13: 67,786,598 C223* probably null Het
Other mutations in Rbm25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Rbm25 APN 12 83659567 missense probably damaging 1.00
IGL02095:Rbm25 APN 12 83671974 missense probably damaging 1.00
IGL02227:Rbm25 APN 12 83672753 missense probably damaging 1.00
IGL02454:Rbm25 APN 12 83660322 missense probably benign 0.02
IGL02704:Rbm25 APN 12 83642726 missense probably damaging 1.00
IGL02726:Rbm25 APN 12 83672852 missense probably damaging 1.00
IGL03384:Rbm25 APN 12 83659523 missense probably benign 0.28
R0380:Rbm25 UTSW 12 83660356 missense probably benign 0.02
R0829:Rbm25 UTSW 12 83660376 splice site probably benign
R1330:Rbm25 UTSW 12 83677892 missense probably damaging 1.00
R1346:Rbm25 UTSW 12 83644393 splice site probably benign
R1518:Rbm25 UTSW 12 83668445 missense possibly damaging 0.91
R1566:Rbm25 UTSW 12 83675054 missense probably damaging 0.98
R1660:Rbm25 UTSW 12 83668150 unclassified probably benign
R1809:Rbm25 UTSW 12 83672727 splice site probably benign
R2213:Rbm25 UTSW 12 83676082 missense probably benign 0.00
R2336:Rbm25 UTSW 12 83651418 missense probably damaging 1.00
R2943:Rbm25 UTSW 12 83660641 missense probably damaging 1.00
R3971:Rbm25 UTSW 12 83675208 missense probably benign 0.03
R4349:Rbm25 UTSW 12 83675173 missense probably damaging 0.99
R4740:Rbm25 UTSW 12 83644407 missense possibly damaging 0.61
R4987:Rbm25 UTSW 12 83677856 missense probably damaging 1.00
R5205:Rbm25 UTSW 12 83672869 missense probably benign 0.03
R5579:Rbm25 UTSW 12 83668507 missense probably benign 0.41
R5603:Rbm25 UTSW 12 83664216 nonsense probably null
R5930:Rbm25 UTSW 12 83677866 missense possibly damaging 0.46
R5982:Rbm25 UTSW 12 83671951 missense probably damaging 0.99
R6233:Rbm25 UTSW 12 83659426 missense probably benign 0.24
R6275:Rbm25 UTSW 12 83644432 missense probably damaging 0.98
R6282:Rbm25 UTSW 12 83676089 missense probably damaging 0.98
R7156:Rbm25 UTSW 12 83664191 missense unknown
R7188:Rbm25 UTSW 12 83663998 missense unknown
R7217:Rbm25 UTSW 12 83664217 missense unknown
R7403:Rbm25 UTSW 12 83676134 missense probably damaging 1.00
R7508:Rbm25 UTSW 12 83672877 missense probably damaging 0.99
R7703:Rbm25 UTSW 12 83675090 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTAAGTCATTGAGTTTGGCTGAATC -3'
(R):5'- ACAGATGGCTTTACACCCGAG -3'

Sequencing Primer
(F):5'- ACTGGACAGTTGTTCTTTTAAGTC -3'
(R):5'- GTGAGTACACAGAGCATCAA -3'
Posted On2017-02-28